» Site Navigation
0 members and 652 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
BPnet Veteran
How would you get a Axanthic Killer Bee
Ok help me out with this. If you started with a spider and pastel you get bee's. You put the bees togeather and get a killer bee. Where do you add the axanthic? How much do axanthic's cost? lol I just LOVE these snakes. Thanks for the help
-
-
Re: How would you get a Axanthic Killer Bee
 Originally Posted by akaangela
Ok help me out with this. If you started with a spider and pastel you get bee's. You put the bees togeather and get a killer bee. Where do you add the axanthic? How much do axanthic's cost? lol I just LOVE these snakes. Thanks for the help
Axanthics are recessive so you need a spider and pastel(or a bumblee bee) that are het or visual for axanthic and breed them to each other.
-
-
Re: How would you get a Axanthic Killer Bee
The easiest route, and I say that loosely, to make axanthic killer bees would be a pastel het axanthic bred to a bumblebee het axanthic.
I'm hoping to hatch out some bees pos het axanthic and tie them up with my pastel axanthics in a few years to hit on the axanthic killers myself.
An awesome looking combo IMO
Last edited by JD Constriction; 11-23-2008 at 10:04 PM.
Reason: typo
-
-
BPnet Veteran
Re: How would you get a Axanthic Killer Bee
I'd say the most basic way to do this would be to start off with an axanthic, a pastel, and a spider. One female and two males. Doesn't really matter which is which, but for the sake of this post ill say a female pastel, becauses that's probably the cheapest. Assuming you buy these as hatchlings thats at least two years you've gotta wait for the female to be up to size. So breed your spider male to the pastel female, and with that pairing you'll get on average:
25% Normal
25% Spider
25% Pastel
25% Bumblebee
So then you keep a female bumblebee from that clutch. Raise that up for another two years and breed that to your axanthic male. With that pairing you should get:
25% Het Axanthic
25% Spider Het Axanthic
25% Pastel Het Axanthic
25% Bumblebee Het Axanthic
Now if you incredibly lucky, you'd get 1.1 Bumblebees out of that clutch, which would both be 100% het Axanthic. Raise that female up another 2 years, and breed those 2 bees together, and you'd get this:
1.5625% Normal
3.125% Het Axanthic
1.5625% Axanthic
3.125% Spider
6.25% Spider Het Axanthic
3.125% Axanthic Spider
1.5625% Homozygous Spider
3.125% Homozygous Spider Het Axanthic
1.5625% Axanthic Homozygous Spider
3.125% Pastel
6.25% Pastel Het Axanthic
3.125% Axanthic Pastel
6.25% Bumblebee
12.5% Bumblebee Het Axanthic
6.25% Axanthic Bumblebee
3.125% Pastel Homozygous Spider
6.25% Pastel Homozygous Spider Het Axanthic
3.125% Axanthic Pastel Homozygous Spider
1.5625% Super Pastel
3.125% Super Pastel Het Axanthic
1.5625% Axanthic Super Pastel
3.125% Killerbee
6.25% Killerbee Het Axanthic,
3.125% AXANTHIC KILLERBEE
1.5625% Super Pastel Homozygous Spider
3.125% Super Pastel Homozygous Spider Het Axanthic
1.5625% Axanthic Super Pastel Homozygous Spider
Sooo, 6 years, and each egg would only have about a 3.125% chance of becoming an Axanthic Killerbee.
Good luck.
OOOOOR, just buy 1.1 Axanthic Killerbees, and breed 'em together:
25% Axanthic Super Pastel
50% Axanthic Killerbee
25% Axanthic Super Pastel Homozygous Spider
-
The Following 4 Users Say Thank You to Peter Williams For This Useful Post:
akaangela (11-24-2008),ifun.jc (07-17-2010),RhacHead (11-24-2008),WizzySRT10 (11-24-2008)
-
Re: How would you get a Axanthic Killer Bee
This will be a long process, with low odds each breeding season, if you start from scratch with base morphs.
To hit the recessive+super co-dom + dom morph combo in a single snake.. Your best bet is to fork out the cash for some nice snakes.
1.1 killerbee axanthic is obviously the best way to make more killerbee axanthics.
If you find snakes that are close to the killerbee axanthic combo, they'd be nice to have for this project. A super pastel axanthic, or even a pastel axanthic would be great to have, for example. If you were able to find a super pastel axanthic and killerbee het axanthic(just off the top of my head, combo morphs that are close to what you are looking for) you would already have a pair that have a possibility of producing killer bee axanthics.
-
-
BPnet Veteran
Re: How would you get a Axanthic Killer Bee
Thanks all. I looked through ALL the pages of KingSnake and could not find a price for a male axanthic. How much would one run? I have the male spider, female pastel (I also have a male pastel. I planned on breeding the spider to the female pastel (hopefully) next year, if she is up to weight. I was hoping to be able to trade a pastel and some money or a superpastel for a male axanthic (who knows how much the price will be then.
thanks for everything
-
-
Registered User
Re: How would you get a Axanthic Killer Bee
 Originally Posted by akaangela
Ok help me out with this. If you started with a spider and pastel you get bee's. You put the bees togeather and get a killer bee. Where do you add the axanthic? How much do axanthic's cost? lol I just LOVE these snakes. Thanks for the help
8ball pythons has 2008 VPI Axanthic ... Males: $600.00, Females: $1,000.00 2008 Pastel ... Male: $100.00 and 2008 Spiders ... Males: $250.00, Females: $350.00 of course plus shipping. There would get you your start to get some good animals started.

1.0 BP VPI Pastel - Dante
0.1 BP Spider- Name Unknown (not shipped yet)
Hopefully another one soon!
-
-
Re: How would you get a Axanthic Killer Bee
Something to remember is that you don't need to breed bee X bee to get a killer bee. You only need one of the parents to contain the spider gene but both must contain the pastel gene.
The odds of hitting on the spider do go up from 50% to 75% but with the wobbles in spiders I would advise against breeding spider to spider unless you were prove out homozygous spider (which hasn't been proven right?).
That being said a super pastel het axanthic X a bee het axanthic would be a much better pairing instead of a pastel het axanthic x a bee het axanthic or bee x bee.
Hope that helps
Last edited by JD Constriction; 11-24-2008 at 08:29 AM.
-
-
Re: How would you get a Axanthic Killer Bee
Pastel Axanthics aren't 1/2 bad in their own right 
-
-
Re: How would you get a Axanthic Killer Bee
I agree with JPman on not having to use a bee x bee but what I do not get is why everyone keeps saying you have to use hets for axanthic in the last step. Personally I think the "easiest" way would be to breed an axanthic bee x super pastel axanthic. No odds to fight against there. Even a axanthic bee x pastel axanthic would be a better bet than breeding hets for axanthic and praying to the odds gods.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|