» Site Navigation
0 members and 1,350 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,128
Posts: 2,572,278
Top Poster: JLC (31,651)
|
-
Registered User
-
-
Re: www.pythonkings.nl v2.0 is back
Awsome! Im way behind on the game but it looks like fun!!
-
-
Re: www.pythonkings.nl v2.0 is back
All users please remember that no Image may be hosted on a site outside of BP.net or that you personally don't own if it is to be used in your signature. This causes severe slowdowns in page load times when the hosting site experiences high amounts of traffic or is offline for any period of time.
If you wish to show that you participate in this game please save the image here or to your domain in order to use it in you signature.
Thanks.
Last edited by Freakie_frog; 11-13-2008 at 10:35 AM.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
The Following User Says Thank You to Freakie_frog For This Useful Post:
-
Re: www.pythonkings.nl v2.0 is back
So, for those of us who are new to this, what is it all about? Can not seem to find any background on it...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: www.pythonkings.nl v2.0 is back
Its an online Ballpython Breeding game. You buy, breed, sale and trade Ball python morphs
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: www.pythonkings.nl v2.0 is back
 Originally Posted by Freakie_frog
Its an online Ballpython Breeding game. You buy, breed, sale and trade Ball python morphs
Imaginary snakes bought with imaginary money. No real money exchanges hands. At least...I hope not! LOL
-
-
Re: www.pythonkings.nl v2.0 is back
Alright, sounds easy enough then. See if I can bumble my way through a few rounds.
Thanks
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|