» Site Navigation
3 members and 1,093 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,146
Posts: 2,572,381
Top Poster: JLC (31,651)
|
-
Registered User
Reputable sites to order BP from?
Hey guys,
Just so I don't commit some sort of terrible mistake, is it okay to order a ball off of a website such as VMSherp.com? I'm dying for a yellowbelly!
Oh and what do you think of paying $150 for a pastel hatchling? Too much?
Hale
-
-
Registered User
Re: Reputable sites to order BP from?

1.0 BP VPI Pastel - Dante
0.1 BP Spider- Name Unknown (not shipped yet)
Hopefully another one soon!
-
-
Re: Reputable sites to order BP from?
You can research dealers on http://www.faunaclassifieds.com/ BOI (Board of Inquiry).
VMSHerp has a good reputation.
-
-
Registered User
Re: Reputable sites to order BP from?
Alice Cobb at www.Floridareptileroom.com is an excellent source. I would highly recommend her. Great customer service. her prices are more than fair.
-
-
BPnet Veteran
Re: Reputable sites to order BP from?
There are lots of breeders on kingsnake.com that you can get great snakes from w/o breaking the bank. but you cant go wrong with BHB.
-
-
Registered User
Re: Reputable sites to order BP from?
I bought my bumblebee from RCReptiles. The snake is fantastic and the breeder shipped her with heating packs and she arrived in great condition. I would buy again from this breeder.
Gary
-
-
BPnet Veteran
Re: Reputable sites to order BP from?
Check out JNJ
They've got some great deals on some SMOKING pastels right now! I got my first pastel from them at a show back a few months ago and they are awesome, customer service is top notch and I know quite a few people that have bought from them with 0 problems and only great things to say.
Also I would definitely check out 8ball as mentioned above. Adam's always got amazing looking animals for sale (don't know about pastels right now but it never hurts to ask lol).
Good luck! Remember, always check the BOI anytime you're thinking of ordering from someone online.
Edit: They've also got a pastel/yellowbelly for sale and some proven breeder YBs as well.
~Adam~
BPs: 3.9 Normals, 1.0 Spider, 1.1 Pastels, 0.1 100% Het Hypo, 1.0 Cinnamon, 0.1 Pinstripe, 0.1 Albino 1.0 Bumblebee .
Bloods: 0.1 Marter line red, 1.0 Het T+ albino red.
Colubrids:1.1 Western Hogs, 0.0.1 Tri-Color Hognose, 1.0 Albino Cal King,
-
-
Re: Reputable sites to order BP from?
I just completed a transaction with Tom Keogan recently. You can find him listing on kingsnake now and again. Great guy and great animals! I would definitely recommend him if he has what you are looking for.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|