» Site Navigation
0 members and 1,030 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,143
Posts: 2,572,365
Top Poster: JLC (31,651)
|
-
Re: What do you do for a Job.
I am a microbial geneticist. I work with germs.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: What do you do for a Job.
Project manager for an electrical distributor and vol firefighter
-
-
Registered User
Re: What do you do for a Job.
Production Supervisor in a Chemical Solutions Mine
-
-
Registered User
Re: What do you do for a Job.
-
-
Registered User
Re: What do you do for a Job.
Ten more days until my medical retirement is completed. Then I will be off to the oil rig.
-
-
BPnet Veteran
Re: What do you do for a Job.
I am a stall mucker, groom, horse exerciser and general caregiver to horses. My favorite job of all time. Can't believe I actually get paid.

~~ZinniaZ
2.1.0 ball python-- James Herriot the Spider BP and Paradox, my son's female normal BP, Jack London, het red axanthic
0.1 Blue Beauty-- Anna Sewall
-
-
BPnet Veteran
Re: What do you do for a Job.
I work at our local community college as a studio lab tech. I also go to school there full time. I currently am looking for another job too but it seems the way the economy is I also will be a burger flipper.
-
-
Registered User
Re: What do you do for a Job.
tattoo artist and freelance graphic designer
-
-
Registered User
Re: What do you do for a Job.
ACS TECH... patch up bullet holes and repair stress fractures in F-18 superhornets and hopefully soon the F-35 JSF, if it ever comes into service
-
-
01-18-2009, 03:39 PM
#100
BPnet Veteran
Re: What do you do for a Job.
I work at a Gas Station, Generally get to do most of what i want, so long as work gets done. Its pretty laid back here, and we get to use our computers and such when things are slow.
Im basically a manager, although i dont carry the "title" But i close and do all the things that managers do.
Its nice to be one of the main employees ( there are two of us, that run the store full time, and four other part timers, and then of course the bosses...)
Its a good job, i really like my bosses and my coworkers. you dont get that very often..... Ive definitely never been happier in any job ive been in!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|