Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,296

1 members and 2,295 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

None

» Stats

Members: 75,870
Threads: 249,065
Posts: 2,571,957
Top Poster: JLC (31,651)
Welcome to our newest member, EMJAY
Results 1 to 8 of 8
  1. #1
    Registered User Bleh's Avatar
    Join Date
    05-27-2020
    Location
    Usually the same room as the reptiles.
    Posts
    125
    Thanks
    76
    Thanked 48 Times in 35 Posts
    Images: 24

    Lucy or Leucistic?

    So I came across an article the other day that detailed some defining features for BP genetics.

    In the list was a description of leucistics and its mix of Mojave's which I sort of already knew (I'm still very much an amateur, here). Then the description for the blue eyed lucy made mention of there being an ever so faint dorsal pattern present and this got me curious about mine...

    So here's Lucy. She's beautiful. So gentle and just shy of 500g right now... the camera doesn't pick up the blue in her eyes very well, but you should be able to see the red in her pupil?! The blue is almost like a magnificent marble in effect.

    Now I have had a good look and can't see any form of dorsal pattern whatsoever... she's pure white, throughout.

    When I purchased her, I was told her possible make up was, and I'm sure there'll be a conflict here, but, she's a;

    Super Lesser Fire,
    Possible super fire,
    Possible vanilla
    Possible pastel
    Possible enchi

    So no mention of Mojave (forgive me if I'm missing something, I'm taking my time and trying to learn slowly).

    Either way, she's a stunner and I'm looking forward to seeing what her and my spotnose produce in a few years time...

    Here's some pics:

    [IMG][/IMG][IMG][/IMG][IMG][/IMG]

  2. #2
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts
    There are several morphs that make up the blue eyed leucistic complex. Any BP that inherits both a gene from their mother in this complex, and a gene from their father in this complex, will end up being some variation of blue eyed leucistic. The possible morphs that make up this complex are:
    -Lesser
    -Butter
    -Mojave
    -Moca
    -Phantom
    -Mystic
    -Russo het leucistic
    -Special
    -Bamboo

    There is a different complex, black eyed leucistic complex, that works a similar way producing a white animal, but has black eyes unless another morph lightens the eyes on top of what is making them white. The morphs in this complex are:
    -Fire
    -Lucifer
    -Sulfur
    -Disco
    -Vanilla
    -Thunder
    -Coffee
    -Flame
    -Ember
    -Mota
    -Brite

    What you have is an animal who has some genes from both complexes, which makes things especially confusing and difficult to identify. Sounds like according to what the breeder knows, she definitely is Super Lesser (so no possibility of Mojave in there because there are only two spots genes from this complex can go, and Lesser is in both of them), and she has at least one copy of Fire. The other spot on the black-eyed leucistic complex could be either Normal*, a second copy of Fire, or Vanilla, but there is no way to tell by looking at her. Blacklight can sometimes help see subtle differences between morphs in white snakes, but having genes from both complexes working together to remove pigment makes is even more difficult than an ordinary BEL. Pastel and Enchi are morphs in different locations of the DNA, which the BEL is making impossible to see are or aren't present by looking at her. Once you breed her and get hatchlings, you should be able to start narrowing down exactly what she does and doesn't have.

    *Normal isn't just one gene, it's basically what we call all the different genes that make up a wild-type animal. In this context, I'm talking about a very specific location of the DNA (black eyed complex) where it may have the type of gene Normals have here or it may have a morph gene.
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  3. The Following User Says Thank You to nikkubus For This Useful Post:

    Bleh (08-04-2021)

  4. #3
    Registered User Bleh's Avatar
    Join Date
    05-27-2020
    Location
    Usually the same room as the reptiles.
    Posts
    125
    Thanks
    76
    Thanked 48 Times in 35 Posts
    Images: 24

    Re: Lucy or Leucistic?

    Quote Originally Posted by nikkubus View Post
    What you have is an animal who has some genes from both complexes, which makes things especially confusing and difficult to identify. Sounds like according to what the breeder knows, she definitely is Super Lesser (so no possibility of Mojave in there because there are only two spots genes from this complex can go, and Lesser is in both of them), and she has at least one copy of Fire. The other spot on the black-eyed leucistic complex could be either Normal*, a second copy of Fire, or Vanilla, but there is no way to tell by looking at her. Blacklight can sometimes help see subtle differences between morphs in white snakes, but having genes from both complexes working together to remove pigment makes is even more difficult than an ordinary BEL. Pastel and Enchi are morphs in different locations of the DNA, which the BEL is making impossible to see are or aren't present by looking at her. Once you breed her and get hatchlings, you should be able to start narrowing down exactly what she does and doesn't have.
    Thanks nikkubus, any suggestions what may be the cause of the red pupils?

    My initial plan is to pair her with my pastel spotnose when she's old enough, but that could change as he's going to be paired with my enchi pin before that time comes, and who knows what males may be worth holding back there, then?!

  5. #4
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts
    It's difficult to say with pupils because it's so much harder to capture on camera what they accurately look like to compare different combos unless a person has them all in person, and there are so many shades on a spectrum between black and bright red like an albino can have.

    Yeah, you could end up with something even better to pair with her. Though the first time or two, I might put something really simple with her just to figure out what exactly she has. The more morphs the male has, the harder ID is going to be on her and hatchlings. Pin in particular could make ID extremely hard, where Pastel and Enchi put you in a situation you are less likely to know if she carries them since you don't know if her or the male threw them. If you hit a super, then you know, but you could miss the odds on that.
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  6. The Following User Says Thank You to nikkubus For This Useful Post:

    Bleh (08-04-2021)

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Based on the pics you posted, your animal is a BlkEL and not a BluEL. Assuming it is not bad angle or poor pic, your animal then is a SuperFire and not a SuperLesser. The blue-eye phenotype is dominant to the black-eye phenotype and your animal has black-eyes
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #6
    Registered User Bleh's Avatar
    Join Date
    05-27-2020
    Location
    Usually the same room as the reptiles.
    Posts
    125
    Thanks
    76
    Thanked 48 Times in 35 Posts
    Images: 24

    Re: Lucy or Leucistic?

    Quote Originally Posted by Bleh View Post
    the camera doesn't pick up the blue in her eyes very well, but you should be able to see the red in her pupil?! The blue is almost like a magnificent marble in effect.
    100% they're blue, just not very good at being picked up with the camera. The image here doesn't do her justice!

    [IMG][/IMG]

  9. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Lucy or Leucistic?

    Quote Originally Posted by Bleh View Post
    100% they're blue, just not very good at being picked up with the camera.
    Definitely a bad angle above then
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #8
    Registered User Bleh's Avatar
    Join Date
    05-27-2020
    Location
    Usually the same room as the reptiles.
    Posts
    125
    Thanks
    76
    Thanked 48 Times in 35 Posts
    Images: 24

    Re: Lucy or Leucistic?

    Quote Originally Posted by asplundii View Post
    Definitely a bad angle above then
    100%

    I can take some lovely pics more often than not, but BP's love making me work for it. No quick pics with these guys

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1