» Site Navigation
0 members and 1,003 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
|
-
Registered User
Lucy or Leucistic?
So I came across an article the other day that detailed some defining features for BP genetics.
In the list was a description of leucistics and its mix of Mojave's which I sort of already knew (I'm still very much an amateur, here). Then the description for the blue eyed lucy made mention of there being an ever so faint dorsal pattern present and this got me curious about mine...
So here's Lucy. She's beautiful. So gentle and just shy of 500g right now... the camera doesn't pick up the blue in her eyes very well, but you should be able to see the red in her pupil?! The blue is almost like a magnificent marble in effect.
Now I have had a good look and can't see any form of dorsal pattern whatsoever... she's pure white, throughout.
When I purchased her, I was told her possible make up was, and I'm sure there'll be a conflict here, but, she's a;
Super Lesser Fire,
Possible super fire,
Possible vanilla
Possible pastel
Possible enchi
So no mention of Mojave (forgive me if I'm missing something, I'm taking my time and trying to learn slowly).
Either way, she's a stunner and I'm looking forward to seeing what her and my spotnose produce in a few years time...
Here's some pics:
[IMG] [/IMG][IMG] [/IMG][IMG] [/IMG]
-
-
There are several morphs that make up the blue eyed leucistic complex. Any BP that inherits both a gene from their mother in this complex, and a gene from their father in this complex, will end up being some variation of blue eyed leucistic. The possible morphs that make up this complex are:
-Lesser
-Butter
-Mojave
-Moca
-Phantom
-Mystic
-Russo het leucistic
-Special
-Bamboo
There is a different complex, black eyed leucistic complex, that works a similar way producing a white animal, but has black eyes unless another morph lightens the eyes on top of what is making them white. The morphs in this complex are:
-Fire
-Lucifer
-Sulfur
-Disco
-Vanilla
-Thunder
-Coffee
-Flame
-Ember
-Mota
-Brite
What you have is an animal who has some genes from both complexes, which makes things especially confusing and difficult to identify. Sounds like according to what the breeder knows, she definitely is Super Lesser (so no possibility of Mojave in there because there are only two spots genes from this complex can go, and Lesser is in both of them), and she has at least one copy of Fire. The other spot on the black-eyed leucistic complex could be either Normal*, a second copy of Fire, or Vanilla, but there is no way to tell by looking at her. Blacklight can sometimes help see subtle differences between morphs in white snakes, but having genes from both complexes working together to remove pigment makes is even more difficult than an ordinary BEL. Pastel and Enchi are morphs in different locations of the DNA, which the BEL is making impossible to see are or aren't present by looking at her. Once you breed her and get hatchlings, you should be able to start narrowing down exactly what she does and doesn't have.
*Normal isn't just one gene, it's basically what we call all the different genes that make up a wild-type animal. In this context, I'm talking about a very specific location of the DNA (black eyed complex) where it may have the type of gene Normals have here or it may have a morph gene.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Registered User
Re: Lucy or Leucistic?
 Originally Posted by nikkubus
What you have is an animal who has some genes from both complexes, which makes things especially confusing and difficult to identify. Sounds like according to what the breeder knows, she definitely is Super Lesser (so no possibility of Mojave in there because there are only two spots genes from this complex can go, and Lesser is in both of them), and she has at least one copy of Fire. The other spot on the black-eyed leucistic complex could be either Normal*, a second copy of Fire, or Vanilla, but there is no way to tell by looking at her. Blacklight can sometimes help see subtle differences between morphs in white snakes, but having genes from both complexes working together to remove pigment makes is even more difficult than an ordinary BEL. Pastel and Enchi are morphs in different locations of the DNA, which the BEL is making impossible to see are or aren't present by looking at her. Once you breed her and get hatchlings, you should be able to start narrowing down exactly what she does and doesn't have.
Thanks nikkubus, any suggestions what may be the cause of the red pupils?
My initial plan is to pair her with my pastel spotnose when she's old enough, but that could change as he's going to be paired with my enchi pin before that time comes, and who knows what males may be worth holding back there, then?!
-
-
It's difficult to say with pupils because it's so much harder to capture on camera what they accurately look like to compare different combos unless a person has them all in person, and there are so many shades on a spectrum between black and bright red like an albino can have.
Yeah, you could end up with something even better to pair with her. Though the first time or two, I might put something really simple with her just to figure out what exactly she has. The more morphs the male has, the harder ID is going to be on her and hatchlings. Pin in particular could make ID extremely hard, where Pastel and Enchi put you in a situation you are less likely to know if she carries them since you don't know if her or the male threw them. If you hit a super, then you know, but you could miss the odds on that.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Based on the pics you posted, your animal is a BlkEL and not a BluEL. Assuming it is not bad angle or poor pic, your animal then is a SuperFire and not a SuperLesser. The blue-eye phenotype is dominant to the black-eye phenotype and your animal has black-eyes
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Lucy or Leucistic?
 Originally Posted by Bleh
the camera doesn't pick up the blue in her eyes very well, but you should be able to see the red in her pupil?! The blue is almost like a magnificent marble in effect.
100% they're blue, just not very good at being picked up with the camera. The image here doesn't do her justice!
[IMG] [/IMG]
-
-
Re: Lucy or Leucistic?
 Originally Posted by Bleh
100% they're blue, just not very good at being picked up with the camera.
Definitely a bad angle above then
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Lucy or Leucistic?
 Originally Posted by asplundii
Definitely a bad angle above then
100%
I can take some lovely pics more often than not, but BP's love making me work for it. No quick pics with these guys
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|