» Site Navigation
0 members and 847 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,904
Threads: 249,099
Posts: 2,572,073
Top Poster: JLC (31,651)
|
View Poll Results: Are enchi and cinammon/ black pastel allelic?
- Voters
- 5. You may not vote on this poll
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by bcr229
Often with the allelic combos the offspring don't look like the parents. I mean, who would have thought that a super lesser/super mohave/lesser mohave/etc would be a white snake with blue eyes if you'd never seen one before? Or a super cinny/super black pastel/etc would be a solid gray/black snake? If you look at a cinnamon enchi or black pastel enchi they look as you'd expect: a mix of the two morphs. Super enchi looks like a reduced enchi, not something wildly different from what you'd expect.
Then there is proving it. It might be easiest to pick out a super enchi + cinnamon or black pastel in a litter, because the other super forms are solid colors which could mask the enchi gene.
I don't know that it would be considered proving it but I would think breeding a cinnamon enchi to any other combo and verifying all babies are enchi or cinnamon but not both would be a pretty good indication that they they are in fact allelic.
-
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by asplundii
If you do locate it, please link here. I would be interested in seeing what all he has done
I'll try to do some digging and see if I can find where I read it. Depending on his results, it may be good enough proof for me. The only issue is, I didn't pay much attention to what all the offspring were other than not black pastel enchi. If all his pairings with his black pastel enchi did produce only one or the other in each pairing, that would pretty much prove it imo. I'll follow up if I can find it.
-
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by rufretic
If all his pairings with his black pastel enchi did produce only one or the other in each pairing, that would pretty much prove it imo.
Yes, this was what I said in my first reply here. A few clutches without replicating the double would be very strong evidence
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Thoughts on cinnamon and enchi being allelic?
Hello everyone just found this thread. In 2017 I paired what was sold to me as a fire pewter to an enchi bumblebee. I produced 5 offspring
1)https://www.instagram.com/p/Bm0uD5Gg...=1u0gdd1s13iuh
2)https://www.instagram.com/p/Bm0tktGA...d=we2492a021kf
3)https://www.instagram.com/p/Bm0uXBbA...d=lkav1ot3liuq
4)https://www.instagram.com/p/Bm0u0T9A...d=qaa4xj5tpvlv
5)https://www.instagram.com/p/Bm0tCT3g...d=208lrr8w6pyi
I held back #1 & #5 because I didn’t know what was in them. In 2019 I bred #1 to a normal female and I produced this.https://www.instagram.com/p/CFPjf5Qs...=1r6mm9969e844
I believe #5 has enchi in her and will try to pair with #1 and see what I get I will also try to reproduce #1 and #5 this year.
-
-
BPnet Veteran
Re: Thoughts on cinnamon and enchi being allelic?
Well I guess i'll jump into this project and see my results for the next few years. I'm going to start pairing a Cinnamon enchi female with my banana pied male and will now not sell a black pastel banana male I had received as part of a trade and instead pair it with an enchi girl I was also considering selling due to her daughter (pastel lesser enchi) being up to size. These are the projects that get me excited, hopefully they produce for me in the next few years and I can post my results.
-
-
Registered User
Re: Thoughts on cinnamon and enchi being allelic?
So over on morph market lol. there is a super cinnamon enchi and i call bull. its by a big breeder too which is pretty disappointing.
Last edited by Bogertophis; 03-01-2021 at 08:42 PM.
Reason: toned down colorful language
-
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by benji4801
So over on morph market lol. there is a super cinnamon enchi and i call bull. its by a big breeder too which is pretty disappointing.

Yeah, it looks like a super cinny to me but there is no way they would be able to tell enchi is in there in that combo (other than that they should know it's not even possible).
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by nikkubus
Yeah, it looks like a super cinny to me but there is no way they would be able to tell enchi is in there in that combo (other than that they should know it's not even possible).
I thought it wasn't proven one way or another yet that enchi and cinnamon were allelic?
-
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by bcr229
I thought it wasn't proven one way or another yet that enchi and cinnamon were allelic?
worldofballpythons.com has changed the genetic calculator to reflect it. Enough people have clutch results from enchi cinnamons that it's safe to say it's proven. When breeding a cinnamon enchi to one that has neither, every single hatchling has one of the two genes, never neither, never both. The only way to produce a cinnamon enchi that we have seen is to have each parent have at least one of the two.
There are many claims of "super enchi cinnamon" and two "super cinnamon enchi" (one of the two is listed "possible enchi") showing up on morph market (including past sales) but if you look at the animals, you have to wonder what gives the people identifying them this idea. I would want to see clutch results from these animals before making the claim they are those things if it were my reputation on the line.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
-
Re: Thoughts on cinnamon and enchi being allelic?
 Originally Posted by nikkubus
worldofballpythons.com has changed the genetic calculator to reflect it.
Apparently I'm imagining things. I swear I saw it just a week or two ago show a 50/50 split out of enchi cinnamon to normal, but I just checked it again now and it's showing them as if they are not allelic. Either way, I stand by the rest of what I said and just wanted to correct that bit.
JKR and MCC have both had multiple clutches that seem to confirm it allelic though. One clutch, two clutches... odds can be a bit crazy sometimes, but when multiple people are seeing it repeated without any evidence to the contrary I think it's too strong of evidence to deny.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|