Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,406

1 members and 1,405 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 4 1234 LastLast
Results 1 to 10 of 35
  1. #1
    Registered User
    Join Date
    04-19-2020
    Posts
    61
    Thanks
    0
    Thanked 5 Times in 5 Posts

    Can someone help me please with a ibd question.

    I have a 10 month old Colombian red tail and I just don’t want to be too careful. She is eating, drinking, moving. She just worked her way up a 27” bamboo branch by inching up there every few inches. When I turn her on her back she sometimes gets stubborn and doesn’t fix herself like when I take her from her hut she doesn’t automatically fix it. She can and does sometimes and when I hold her by her tail she usually can get back up on my hand. She has some trouble on my tile but never ties herself into knots like that. I have never seen her corkscrew. She hasn’t pooped since October but she did miss 2 weeks of food. She does have some wrinkles and soaks in her water dish but that might be because she is low on humidity right now. I have been spraying her soil with a water bottle. Her ceramic heat emitters eaither get too hot or not get hot enough so I am using her red lamp from when she was a baby. The last ceramic heat emitter blew a fuse and flew sparks into her room. I just want to make sure that these aren’t ibd symptoms because that one is the one that really scares me. Will someone help me please?

  2. #2
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,825
    Thanks
    29,436
    Thanked 20,605 Times in 12,314 Posts
    IBD is not common, though it's normal for any caring snake owner to be a little paranoid about it. It's not clear to me why you'd even be worried about it? How long have you had her? Any other snakes? Did you quarantine her? The "missing feces" wouldn't concern me- snakes don't "go" once per meal anyway, only when they need to, & young snakes eating younger (more digestible) prey often have very little waste leftover, so they hold it until it's worth the effort, ok? (Snakes also conserve water this way.) A snake with IBD is often blatantly uncoordinated- you can google some YouTubes to see what I mean. Not being a perfect gymnast isn't the same thing, LOL. Does sound like you need to fix her humidity though- what substrate are you using? The right one can help a lot, or adding a good-sized "humid hide" with damp moss in it. You also didn't give the cage temps. (highest, lowest, & ambient) & if you're heating this boa like a ball python, it's no wonder she's dehydrated! Boas need a bit cooler temps than BPs. And all your heating devices (including lights if any) NEED to be on a thermostat (preferably) or a dimmer control at the very least. You are HARMING this snake if the cage is routinely too hot...FIX your husbandry. I don't think your snake has IBD, but snakes CAN get neurological damage from being overheated!!! And don't hold a snake by their tail, especially not a heavy-bodied type like a boa. You wouldn't like it either, I promise.
    Last edited by Bogertophis; 11-24-2020 at 01:09 AM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  3. #3
    Registered User
    Join Date
    04-19-2020
    Posts
    61
    Thanks
    0
    Thanked 5 Times in 5 Posts

    Re: Can someone help me please with a ibd question.

    She will always fix herself in less than 2 minutes but sometimes she doesn’t always fix herself. The light I am using right now stays at 80 perfectly and she will actually stay under it because with the heat emitters I would always find her under the cool side freezing. The red light makes her happy and she is use to it because I used it when she was a itty bitty baby. I also don’t know her exact birthday because she was from a pet store but I got her in late January. No my last snake died in may and when she was a baby I put her on newspapers. She is also on eco earth and has a moss rope and moss in there. I ordered her a new fogger that looks like a tree stump and had a light flow because my other one makes everything soaking wet. The room temp is about 70 because the heat always stays at 65 at night. I am also worried because a article and video said that they can still get up but it just takes a little longer and sometimes she doesn’t automatically right herself. She is a little wobble sometimes getting up on my hand by climbing herself but she doesn’t flip her head upside down usually unless she has a fall which has happened like once.
    Last edited by 4Dobermans; 11-24-2020 at 01:17 AM.

  4. #4
    Registered User
    Join Date
    04-19-2020
    Posts
    61
    Thanks
    0
    Thanked 5 Times in 5 Posts

    Re: Can someone help me please with a ibd question.

    It’s around 80 in the hot side, the air is 72. As long as she doesn’t start laying upside down, flinging her head upside down, or regurgitating she should be fine? She doesn’t always get up super fast and I read that even with ibd they can get up just a little slower and sometimes I have to rub her to get her to right herself. She just ate on Saturday and I haven’t noticed any regurgitating pieces in her room. Sometimes she is a bit wobbly getting up my hand and falls off sometimes, is that alright? What are the symptoms for ibd? And is it normal for them to lay on their heads or sideways in their hut, she puts her head sideways because she always goes to the smaller one, but I bought her a new one for Christmas.
    Last edited by 4Dobermans; 11-24-2020 at 02:26 AM.

  5. #5
    Registered User
    Join Date
    04-19-2020
    Posts
    61
    Thanks
    0
    Thanked 5 Times in 5 Posts

    Re: Can someone help me please with a ibd question.

    Will pepper be alright? I am super nervous about ibd .

  6. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If you are really worried about IDB then you can get the animal tested. It beats second guessing and speculating

    http://www.vetdna.com/test-type/reptiles
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (11-24-2020),jmcrook (11-24-2020)

  8. #7
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,572
    Thanks
    2,977
    Thanked 10,009 Times in 4,841 Posts
    Images: 34

    Re: Can someone help me please with a ibd question.

    Quote Originally Posted by 4Dobermans View Post
    It’s around 80 in the hot side, the air is 72. As long as she doesn’t start laying upside down, flinging her head upside down, or regurgitating she should be fine? She doesn’t always get up super fast and I read that even with ibd they can get up just a little slower and sometimes I have to rub her to get her to right herself. She just ate on Saturday and I haven’t noticed any regurgitating pieces in her room. Sometimes she is a bit wobbly getting up my hand and falls off sometimes, is that alright? What are the symptoms for ibd? And is it normal for them to lay on their heads or sideways in their hut, she puts her head sideways because she always goes to the smaller one, but I bought her a new one for Christmas.
    It doesn't sound like your snake has IBD.

    You need to fix your enclosure temps, they should be about 78*F low, 88*F high.

  9. The Following User Says Thank You to bcr229 For This Useful Post:

    Bogertophis (11-24-2020)

  10. #8
    Registered User
    Join Date
    04-19-2020
    Posts
    61
    Thanks
    0
    Thanked 5 Times in 5 Posts

    Re: Can someone help me please with a ibd question.

    I tried once before to do it and they couldn’t because of something I can’t remember. Plus why would I try to take her to the vet if that could expose her to sick animals? As long as she doesn’t do any of those symptoms shouldn’t she be fine. I am always super scared about it because thats what my first bp died of and the first one infected the second bp so they both died. I guess it’s just going to be one of those things that I am super cautious over.
    Last edited by 4Dobermans; 11-24-2020 at 12:53 PM.

  11. #9
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,825
    Thanks
    29,436
    Thanked 20,605 Times in 12,314 Posts

    Re: Can someone help me please with a ibd question.

    Quote Originally Posted by 4Dobermans View Post
    ... I am always super scared about it because thats what my first bp died of and the first one infected the second bp so they both died...
    Sorry about your losses- now your question is making more sense. How long did you wait after the last one died before getting another snake? Did you thoroughly disinfect everything? Personally, if I had a snake that died of IBD (& it was confirmed), I would NOT get another snake for at least a year, to prevent contagion. I hope you waited at least 6 months?
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  12. #10
    Registered User
    Join Date
    04-19-2020
    Posts
    61
    Thanks
    0
    Thanked 5 Times in 5 Posts

    Re: Can someone help me please with a ibd question.

    As long as she still can climb up things, eat and slither. Also what would be the reason for some of her scales to be bent or sticking out without any mites.

Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1