Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 613

0 members and 613 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 6 of 6
  1. #1
    Registered User Tytysi's Avatar
    Join Date
    03-09-2020
    Posts
    32
    Thanks
    0
    Thanked 10 Times in 7 Posts
    Images: 5

    Super Black Pastel Suma ??

    So I'm looking into different all black morphs. Cinnamon Sumas are absolutely my favorite, but I'm curious what a Super Black Pastel Suma would look like instead. I haven't been able to find any pythons with bother Supers. In fact, I can't even find one with just one Super! Is it possible that this is a fatal combo?? Or maybe I'm not looking hard enough. Either way, any help is appreciated!
    0.1 Normal [Artemis]
    0.1 Super Pastel [Persephone]
    1.0 Pastave [Chronos]
    1.0 Blizzard Leopard Gecko [Dimitri]
    1.1 Cats [Jesse McCree, Addison Sheppard]

  2. #2
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Super Black Pastel Suma ??

    It's not lethal, but pretty over kill as far as necessary for darkness. I will not make super black pastel/cinny combos because of the common health issues they can have with kinking and duckbills but I do have a few sumas and am working on adding cinny and ghi into my Suma pied projects to darken them up without the health risks.

    Sent from my Pixel 3 using Tapatalk

  3. #3
    Registered User Tytysi's Avatar
    Join Date
    03-09-2020
    Posts
    32
    Thanks
    0
    Thanked 10 Times in 7 Posts
    Images: 5

    Re: Super Black Pastel Suma ??

    Quote Originally Posted by Hannahshissyfix View Post
    It's not lethal, but pretty over kill as far as necessary for darkness. I will not make super black pastel/cinny combos because of the common health issues they can have with kinking and duckbills but I do have a few sumas and am working on adding cinny and ghi into my Suma pied projects to darken them up without the health risks.

    Sent from my Pixel 3 using Tapatalk
    Ah, that makes sense. I don't want to risk any health issues if it can be helped. Thank you for your input!

    I'm not sure if it would be rude or taboo to ask here on the forums, but if you're looking to sell a Suma, I'd certainly be interested! If not, no worries. I appreciate your help regardless
    0.1 Normal [Artemis]
    0.1 Super Pastel [Persephone]
    1.0 Pastave [Chronos]
    1.0 Blizzard Leopard Gecko [Dimitri]
    1.1 Cats [Jesse McCree, Addison Sheppard]

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Suma Cinny and Suma BlkPastel have both been made. They hatch out darker than a typical SuperCinny or SuperBlk but they eventually brown out some, the same as those others do.

    There was also a Suma GHI made that was quite dark, I have not seen any pics of it since it matured however
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #5
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Super Black Pastel Suma ??

    Quote Originally Posted by Tytysi View Post
    Ah, that makes sense. I don't want to risk any health issues if it can be helped. Thank you for your input!

    I'm not sure if it would be rude or taboo to ask here on the forums, but if you're looking to sell a Suma, I'd certainly be interested! If not, no worries. I appreciate your help regardless
    I have my last sumas of the year hatching currently but they were claimed months ago. Sales directly in the forum aren't allowed but you can always PM people. I'd suggest finding someone producing them and get on their wait list. The last few years when I've posted any on MM they've been sold within hours. I'm sure you'll find what you're looking for eventually!

    Sent from my Pixel 3 using Tapatalk

  6. #6
    Registered User Tytysi's Avatar
    Join Date
    03-09-2020
    Posts
    32
    Thanks
    0
    Thanked 10 Times in 7 Posts
    Images: 5

    Re: Super Black Pastel Suma ??

    Quote Originally Posted by asplundii View Post
    Suma Cinny and Suma BlkPastel have both been made. They hatch out darker than a typical SuperCinny or SuperBlk but they eventually brown out some, the same as those others do.

    There was also a Suma GHI made that was quite dark, I have not seen any pics of it since it matured however
    I think that even regular Suma is gorgeous. I really enjoy the golden red strip down the dorsal!


    Quote Originally Posted by Hannahshissyfix View Post
    I have my last sumas of the year hatching currently but they were claimed months ago. Sales directly in the forum aren't allowed but you can always PM people. I'd suggest finding someone producing them and get on their wait list. The last few years when I've posted any on MM they've been sold within hours. I'm sure you'll find what you're looking for eventually!

    Sent from my Pixel 3 using Tapatalk
    Oo, thank you for the insight! I've contacted a few independent breeders, but no luck so far. Just gotta keep my eyes peeled I suppose! Thank you
    0.1 Normal [Artemis]
    0.1 Super Pastel [Persephone]
    1.0 Pastave [Chronos]
    1.0 Blizzard Leopard Gecko [Dimitri]
    1.1 Cats [Jesse McCree, Addison Sheppard]

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1