Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 667

0 members and 667 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,113
Posts: 2,572,172
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,799
    Thanks
    29,374
    Thanked 20,572 Times in 12,293 Posts

    Snakes could be the source of the Wuhan coronavirus outbreak

    Snakes could be the source of the Wuhan coronavirus outbreak


    By Haitao Guo, Guangxiang "George" Luo and Shou-Jiang Gao, The Conversation
    Updated 8:18 PM ET, Wed January 22, 2020



    https://www.cnn.com/2020/01/22/healt...ner/index.html

    (CNN)Snakes -- the Chinese krait and the Chinese cobra -- may be the original source of the newly discovered coronavirus that has triggered an outbreak of a deadly infectious respiratory illness in China this winter.



    Wuhan coronavirus death toll rises, as city imposes transport lackdown


    The many-banded krait (Bungarus multicinctus), also known as the Taiwanese krait or the Chinese krait, is a highly venomous species of elapid snake found in much of central and southern China and Southeast Asia.
    The illness was first reported in late December 2019 in Wuhan, a major city in central China, and has been rapidly spreading. Since then, sick travelers from Wuhan have infected people in China and other countries, including the United States.





    Using samples of the virus isolated from patients, scientists in China have determined the genetic code of the virus and used microscopes to photograph it. The pathogen responsible for this pandemic is a new coronavirus. It's in the same family of viruses as the well-known severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV), which have killed hundreds of people in the past 17 years. The World Health Organization (WHO) has named the new coronavirus 2019-nCoV.
    We are virologists and journal editors and are closely following this outbreak because there are many questions that need to be answered to curb the spread of this public health threat.
    What is a coronavirus?

    The name of coronavirus comes from its shape, which resembles a crown or solar corona when imaged using an electron microscope.


    A visual guide to the Wuhan coronavirus


    The electron microscopic image, reveals the crown shape structural details for which the coronavirus was named. This image is of the Middle East respiratory syndrome coronavirus (MERS-CoV). National Institute of Allergy and Infectious Diseases (NIAID)
    Coronavirus is transmitted through the air and primarily infects the upper respiratory and gastrointestinal tract of mammals and birds. Though most of the members of the coronavirus family only cause mild flu-like symptoms during infection, SARS-CoV and MERS-CoV can infect both upper and lower airways and cause severe respiratory illness and other complications in humans.
    This new 2019-nCoV causes similar symptoms to SARS-CoV and MERS-CoV. People infected with these coronaviruses suffer a severe inflammatory response.
    Unfortunately, there is no approved vaccine or antiviral treatment available for coronavirus infection. A better understanding of the life cycle of 2019-nCoV, including the source of the virus, how it is transmitted and how it replicates are needed to both prevent and treat the disease.
    Read: What exactly is a coronavirus?
    Zoonotic transmission

    Both SARS and MERS are classified as zoonotic viral diseases, meaning the first patients who were infected acquired these viruses directly from animals. This was possible because while in the animal host, the virus had acquired a series of genetic mutations that allowed it to infect and multiply inside humans.


    First US case of Wuhan coronavirus confirmed by CDC


    Now these viruses can be transmitted from person to person. Field studies have revealed that the original source of SARS-CoV and MERS-CoV is the bat, and that the masked palm civets (a mammal native to Asia and Africa) and camels, respectively, served as intermediate hosts between bats and humans.
    In the case of this 2019 coronavirus outbreak, reports state that most of the first group of patients hospitalized were workers or customers at a local seafood wholesale market which also sold processed meats and live consumable animals including poultry, donkeys, sheep, pigs, camels, foxes, badgers, bamboo rats, hedgehogs and reptiles. However, since no one has ever reported finding a coronavirus infecting aquatic animals, it is plausible that the coronavirus may have originated from other animals sold in that market.


    Life inside ground zero of Wuhan coronavirus outbreak


    The hypothesis that the 2019-nCoV jumped from an animal at the market is strongly supported by a new publication in the Journal of Medical Virology. The scientists conducted an analysis and compared the genetic sequences of 2019-nCoV and all other known coronaviruses.
    The study of the genetic code of 2019-nCoV reveals that the new virus is most closely related to two bat SARS-like coronavirus samples from China, initially suggesting that, like SARS and MERS, the bat might also be the origin of 2019-nCoV. The authors further found that the viral RNA coding sequence of 2019-nCoV spike protein, which forms the "crown" of the virus particle that recognizes the receptor on a host cell, indicates that the bat virus might have mutated before infecting people.
    How influenza jumped from animals to humans
    But when the researchers performed a more detailed bioinformatics analysis of the sequence of 2019-nCoV, it suggests that this coronavirus might come from snakes.
    The Wuhan Huanan Wholesale Seafood Market, where the coronavirus outbreak is believed to have started, is now closed.
    From bats to snakes

    The researchers used an analysis of the protein codes favored by the new coronavirus and compared it to the protein codes from coronaviruses found in different animal hosts, like birds, snakes, marmots, hedgehogs, manis, bats and humans. Surprisingly, they found that the protein codes in the 2019-nCoV are most similar to those used in snakes.
    Get CNN Health's weekly newsletter
    Sign up here to get The Results Are In with Dr. Sanjay Gupta every Tuesday from the CNN Health team.



    Snakes often hunt for bats in wild. Reports indicate that snakes were sold in the local seafood market in Wuhan, raising the possibility that the 2019-nCoV might have jumped from the host species -- bats -- to snakes and then to humans at the beginning of this coronavirus outbreak. However, how the virus could adapt to both the cold-blooded and warm-blooded hosts remains a mystery.
    The authors of the report and other researchers must verify the origin of the virus through laboratory experiments. Searching for the 2019-nCoV sequence in snakes would be the first thing to do. However, since the outbreak, the seafood market has been disinfected and shut down, which makes it challenging to trace the new virus' source animal.
    3 reasons the US is not ready for a pandemic


    Sampling viral RNA from animals sold at the market and from wild snakes and bats is needed to confirm the origin of the virus. Nonetheless, the reported findings will also provide insights for developing prevention and treatment protocols.
    The 2019-nCoV outbreak is another reminder that people should limit the consumption of wild animals to prevent zoonotic infections.



    Copyright 2019 The Conversation. Some rights reserved.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  2. #2
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,799
    Thanks
    29,374
    Thanked 20,572 Times in 12,293 Posts
    Just sharing this as found...seems fairly preliminary yet, but lets hope that snakes don't ultimately get blamed for this...they have enough 'haters' as it is.

    https://www.cnn.com/2020/01/22/healt...ons/index.html

    https://www.cnn.com/2020/01/20/healt...ned/index.html
    Last edited by Bogertophis; 01-22-2020 at 09:36 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  3. The Following User Says Thank You to Bogertophis For This Useful Post:

    richardhind1972 (01-23-2020)

  4. #3
    BPnet Senior Member richardhind1972's Avatar
    Join Date
    12-31-2017
    Location
    derbyshire, uk
    Posts
    4,691
    Thanks
    11,145
    Thanked 7,240 Times in 3,236 Posts

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    I thought that too, thats them all going get killed then, they eat a lot of snakes in China anyway, it may stop them doing that tho

    Sent from my CLT-L09 using Tapatalk

  5. The Following User Says Thank You to richardhind1972 For This Useful Post:

    Bogertophis (01-24-2020)

  6. #4
    Registered User NebulaJam's Avatar
    Join Date
    01-21-2020
    Posts
    52
    Thanks
    19
    Thanked 33 Times in 15 Posts

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Just another snake hating article I hope. Poor snakes already have a bad rep. Sadly now we’ll probably see a culling. Sad indeed.

  7. #5
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts
    Snakes is used mostly for wine. It is believed the wine will boost your health, especially for the sick or weak. The meat is sometimes eaten but they are best used stuffed inside a bottle and made into wine. This, among many other animals used in the Chinese medicine industry, has been practiced for centuries. So I am not surprised at all or doubt this is how the virus would spread.

    And no matter how many the virus infects, it is a practice that won't stop easily. While many prefers Western medicine, a lot of people still relies on the alternative medicine, especially in the poor areas of the country where access and affordability for medication is not there. Many of the customers who but and make this wine don't do it only for themselves; it is usually as a gift for a friend or loved one, as a sign that you want them to get better or stay healthy.

    There is no snake hating in our culture, or hating of any kind. It is the admiration of snakes that led to the idea that turning them into wine or food can help people feel better. It is a false belief, but one strongly rooted in the culture. In order to change the centuries old practice, proper education and awareness, inspection into health infrastructure and accessibility to affordable medicine are one of the main keys, something that China is not going to do.

    I wish the news network would explain that more in details.

  8. The Following 7 Users Say Thank You to Cheesenugget For This Useful Post:

    aurum (01-23-2020),Bogertophis (01-23-2020),John1982 (01-23-2020),Luvyna (01-24-2020),richardhind1972 (01-23-2020),Timelugia (01-23-2020),WrongPython (01-24-2020)

  9. #6
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,569
    Thanks
    2,969
    Thanked 10,003 Times in 4,838 Posts
    Images: 34

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Quote Originally Posted by Cheesenugget View Post
    Snakes is used mostly for wine. It is believed the wine will boost your health, especially for the sick or weak. The meat is sometimes eaten but they are best used stuffed inside a bottle and made into wine. This, among many other animals used in the Chinese medicine industry, has been practiced for centuries. So I am not surprised at all or doubt this is how the virus would spread.
    Interesting. I don't think a virus would last long in wine due to the alcohol content though.

    Usually virii are transmitted via droplets of saliva or mucous from an infected host that we touch, and then we rub our own eye or nose. So, perhaps someone handled an infected critter and picked it up that way.

  10. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    And for a less media-biased hysterical perspective on this:

    https://www.nature.com/articles/d41586-020-00180-8
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (01-24-2020),Bogertophis (01-24-2020),WrongPython (01-24-2020)

  12. #8
    BPnet Veteran WrongPython's Avatar
    Join Date
    06-08-2019
    Posts
    545
    Thanks
    1,559
    Thanked 1,813 Times in 492 Posts

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Been following this since it hit the news yesterday. I'm not a virologist (not my branch of science), but I'm with the ones quoted in the Nature article - I find it a bit odd that a virus normally associated with a warm-blooded hosts would use a cold-blooded one as an intermediary. A bat being the original source of the virus seems much more likely. Perhaps something happened along the lines of "snake eats infected bat, snake starts digesting bat and builds up virus particles in its body, snake is harvested and used to make wine before fully digesting bat, virus particles from snake and partially digested bat seep into wine, people consume virus-laden wine."

    I'm not sure what the alcohol concentration of snake wine is, but it might not be strong enough to kill off viruses (I believe the necessary concentration is 70%). One infected bottle or batch of wine shared among a group of people might have been all it took to start this all off.
    0.1 Sonoran Boa sigma​: "Adelita" ('19 Hypo het. leopard)
    1.0 Boa imperator longicauda: "Kuzco" ('19 het. anery)
    0.1 West Papuan Morelia spilota​: "Pandora" ('20)

  13. #9
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,901
    Thanks
    862
    Thanked 4,090 Times in 1,507 Posts
    Images: 120

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Wuhan BSL-4 rated Virus Research Facility or Wuhan Exotic Meat Market--tough call figuring out the origin of this virus.

    https://themindunleashed.com/2020/01...-outbreak.html

    https://www.nature.com/news/inside-t...hogens-1.21487
    Last edited by Lord Sorril; 01-24-2020 at 07:57 PM.
    *.* TNTC

  14. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Bogertophis (01-24-2020)

  15. #10
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,799
    Thanks
    29,374
    Thanked 20,572 Times in 12,293 Posts

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Quote Originally Posted by WrongPython View Post
    ...
    I'm not sure what the alcohol concentration of snake wine is, but it might not be strong enough to kill off viruses (I believe the necessary concentration is 70%). One infected bottle or batch of wine shared among a group of people might have been all it took to start this all off.
    I don't think it's a matter of drinking virus-laden wine, not at all. If I'm not mistaken, the Wuhan market has live animals for sale...a "meat market" in Asia is nothing like
    going to a grocery store here in the states. (I've lived in Korea for a while, many moons ago. ) But either way, I think Lord Sorril is on the right track here...

    And FYI, I posted this article originally not because I believed it to be fully accurate, but because it was of interest to us snake-keepers as to what's in the news.
    Last edited by Bogertophis; 01-24-2020 at 08:10 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1