Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 685

2 members and 683 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,904
Threads: 249,099
Posts: 2,572,073
Top Poster: JLC (31,651)
Welcome to our newest member, GeneticArtist
Results 1 to 9 of 9
  1. #1
    BPnet Veteran fatSNAKEs's Avatar
    Join Date
    01-14-2009
    Location
    Kansas City
    Posts
    292
    Thanks
    296
    Thanked 321 Times in 132 Posts

    Help Requested - ID Morph Super Form?

    greetings, so I'm requesting help from the BP community at large on opinions to ID a couple of new morphs in my last clutch. Pairing here is a Calico-Pastel female to a new Gray Matter male that I acquired in the past year. [I produced the mom, no other genes are present] My goal with this pairing was to produce a pewter-based female to add to my Gray Matter project. For starters, here is a pic of one of the many locks of mom/dad:


    The pairing produce a small, four-egg clutch that hatched early August. Here's a pic of the entire clutch:


    In addition to the Cinnamon & Calico-Pewter, It produced a pair of BEL-like all-white animals, that both BP Wizard & Morph-market calculator do not identify as super forms for this pairing. The first one that emerged I assumed was paradox, but then the second being identical, it was clearly genetic. Beautiful animals, all white, with a very small purple blush patch on the head (ala Super Mojave) and note the unique yellow coloring in the neck line:


    ... My question to the community and BP experts, understand Gray Matter is arguably early in many projects, and possibly little history exists at this point ... but question whether anyone has seen similar results? Anybody produced an all-white version breeding Gray Matter to another morph, like in my case Calico-Pastel?

    Feedback is appreciated by all ... just trying to figure out where I landed here. thanks!
    David
    ______________________
    view my website:
    http://www.tornadoalleyreptiles.com/

  2. #2
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    The only thing I can think of that it could be is that calico and champagne make for a white snake. I don't know this for sure but I can't find anything to prove otherwise and I was able to find one pic of a calico champagne and while it wasn't as white as yours, it does have a white appearance. It did not have cinnamon in the mix but like other white combos, other genes can be masked. So my guess is that your white snakes are calico champagne cinnamon.

  3. The Following User Says Thank You to rufretic For This Useful Post:

    fatSNAKEs (08-16-2019)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by rufretic View Post
    So my guess is that your white snakes are calico champagne cinnamon.
    But I do not see Champagne as being listed in either of the parents...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    fatSNAKEs (08-16-2019)

  6. #4
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by asplundii View Post
    But I do not see Champagne as being listed in either of the parents...
    Maybe I misunderstood op but I thought the male parent is grey matter which I believe is champagne super cinny?

  7. The Following User Says Thank You to rufretic For This Useful Post:

    fatSNAKEs (08-16-2019)

  8. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by rufretic View Post
    Maybe I misunderstood op but I thought the male parent is grey matter which I believe is champagne super cinny?
    Ah, then the error must be on my end. I thought GreyMatter was a SuperPewter Pied.

    If GM does have Champ then my bet is the animals in question are Champagne Calico Pewter. The Champ Pastel looks very similar upon hatching and the synergy of Calico wiping out pattern when combined with Pastel is also pretty common so stacking those three together I can see leading to a whitish snake
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following User Says Thank You to asplundii For This Useful Post:

    fatSNAKEs (08-16-2019)

  10. #6
    BPnet Veteran fatSNAKEs's Avatar
    Join Date
    01-14-2009
    Location
    Kansas City
    Posts
    292
    Thanks
    296
    Thanked 321 Times in 132 Posts

    Re: Help Requested - ID Morph Super Form?

    hey guys, sorry for the delay was distracted by work. Appreciate your insights ... I'm in agreement with your thinking. Likely will go with Champagne Calico Pewter and call it good. This Gray Matter project feels like it will yield more surprises down the line. Not many out there yet, which I find interesting. thanks!
    David
    ______________________
    view my website:
    http://www.tornadoalleyreptiles.com/

  11. The Following User Says Thank You to fatSNAKEs For This Useful Post:

    rufretic (08-16-2019)

  12. #7
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    what super form are u referring to in your thread title? those genes (Calico Pastel x Grey Matter) should not result in a super but your Pewter Calico does look like a Sterling Calico. iLove it's paradox look, maybe it is one. and is this one a girl that u can pair back to the Grey Matter?

    anyways iLove Champs and missed the mark on a reg Grey Matter last season. your 2 Champ combos would have their colors come in as they mature if Pastel is in there.

    small clutch, but good odds and nice bb BP's in there. congrats!
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  13. The Following User Says Thank You to Ax01 For This Useful Post:

    fatSNAKEs (08-16-2019)

  14. #8
    BPnet Veteran fatSNAKEs's Avatar
    Join Date
    01-14-2009
    Location
    Kansas City
    Posts
    292
    Thanks
    296
    Thanked 321 Times in 132 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by Ax01 View Post
    what super form are u referring to in your thread title? those genes (Calico Pastel x Grey Matter) should not result in a super but your Pewter Calico does look like a Sterling Calico. iLove it's paradox look, maybe it is one. and is this one a girl that u can pair back to the Grey Matter?

    anyways iLove Champs and missed the mark on a reg Grey Matter last season. your 2 Champ combos would have their colors come in as they mature if Pastel is in there.

    small clutch, but good odds and nice bb BP's in there. congrats!

    thanks for the feedback, my comments:

    ... super form, actually I just threw it out there. I agree, don't believe the all-white pair are a super form, I'm just trying to assess the possible identity.

    ... Sterling Calico ... interesting, I'll explore that further. Like I said, first time for me so point of inquiry here was to learn from the community. Its a male BTW which sucks, I needed another female to expand the project. But he's very nice.

    Champs? not familiar with this morph, will do some homework and explore further!

    Again thanks ... like I said just trying to learn here.
    David
    ______________________
    view my website:
    http://www.tornadoalleyreptiles.com/

  15. #9
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by Ax01 View Post
    what super form are u referring to in your thread title? those genes (Calico Pastel x Grey Matter) should not result in a super but your Pewter Calico does look like a Sterling Calico. iLove it's paradox look, maybe it is one. and is this one a girl that u can pair back to the Grey Matter?

    anyways iLove Champs and missed the mark on a reg Grey Matter last season. your 2 Champ combos would have their colors come in as they mature if Pastel is in there.

    small clutch, but good odds and nice bb BP's in there. congrats!
    Quote Originally Posted by fatSNAKEs View Post
    thanks for the feedback, my comments:

    ... super form, actually I just threw it out there. I agree, don't believe the all-white pair are a super form, I'm just trying to assess the possible identity.

    ... Sterling Calico ... interesting, I'll explore that further. Like I said, first time for me so point of inquiry here was to learn from the community. Its a male BTW which sucks, I needed another female to expand the project. But he's very nice.

    Champs? not familiar with this morph, will do some homework and explore further!

    Again thanks ... like I said just trying to learn here.
    Champs is just short for Champagnes. some shortened names confuse me also like when i first heard Champins. those are just Champagne Pinstripes lol!
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1