» Site Navigation
0 members and 987 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,142
Posts: 2,572,350
Top Poster: JLC (31,651)
|
-
Registered User
Please help, new bp, BEL v White wedding COLOR
Hello,
I have a few bps, my favorite a white wedding spied girl (Black eyes). I’d really like to get another white snake but this time a BEL. I’ve researched around the web, YouTube, and some old posts but no one has ever has experienced a comparison of a super lesser BEL (which I think is the most stark white of the BELs - please correct me if I’m wrong) and a white wedding spied.
I was was wondering if any aficionados or breeders have seen comparisons of the two and if the BEL can never compare to the stark white of a WW when the bo reaches adulthood.
I have the option of purchasing another WW (from the same clutch as my girl). If the BEL can’t compare then I’ll bring him home.
And no I do not plan to breed, I just love loving bps.
Thank you for the help!
-
-
Re: Please help, new bp, BEL v White wedding COLOR
 Originally Posted by CCBaer
I was was wondering if any aficionados or breeders have seen comparisons of the two and if the BEL can never compare to the stark white of a WW when the bo reaches adulthood.
I do not have any Pied animals but I have a SuperFire, a Hypo Lesser/Mojave and I had an Ivory Butter OD Pastel so I know a bit about white snakes. I have also visited a number of friend's collections and seen adults of a bunch of things.
The most stark white snakes I have seen are the all-white BlkELs. The white I have seen on adult high-percentage Pied animals is the same degree of stark white so I would believe that an all-white Pied combo would be equal in that regard.
Every BluEL adult I have seen has had some faint level of pigmentation to them, they are more cream-coloured than white. I have also yet to see an adult BluEL of any type that does not have some kind of faintly visible dorsal stripe
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
bcr229 (08-01-2019),CCBaer (08-01-2019),PartySnake13 (08-15-2019)
-
Registered User
Re: Please help, new bp, BEL v White wedding COLOR
Thank you so much for the input, greatly appreciated and what I was looking for.
btw, lovely collection of white snakes you got there!
-
-
i agree w/ Dr. Ash. an all white BlackEL like a patternless Super Fire will be brighter and whiter than white BlueEL's. also i have an adult Lied (Lesser Pied) who has stayed all white since i got her as a hatchling. the whites in Pieds stay white and vibrant but sometimes they do develop a black freckle here and there butt i haven't seen that on all white Pieds yet.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Registered User
Re: Please help, new bp, BEL v White wedding COLOR
beLI am agree with answers. If you are lloking for a full white nothing is more white than the one in a piebald. I would say go for a BEL anyways there are gorgeous. I have a bamboo.mojave BEL and a pied and its just a different taste having both. Those blue eyes have no comparison.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|