» Site Navigation
1 members and 545 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,104
Posts: 2,572,106
Top Poster: JLC (31,651)
|
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by rufretic
On most enchi combos I agree with you but out of the enchi woma and super enchi womas I've seen, it doesn't seem to have that same yellowing effect, they stay more of a brown tan.
 Originally Posted by rufretic
On this animal the pattern is just so reduced, I would think it had enchi if not super enchi. Because of its light color and blushed head stamp I do believe it has fire. What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me.
 Originally Posted by Godzilla78
I concur. Definite super enchi woma with that awesome reduction!
 Originally Posted by rufretic
What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me.
Rufretic, Godzilla,
With respect, might I ask if either of you actually work with the Woma morph?
I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.
Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.
You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.
Dolo,
Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Dolo (05-31-2019),rufretic (05-28-2019)
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by asplundii
Rufretic, Godzilla,
With respect, might I ask if either of you actually work with the Woma morph?
I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.
Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.
You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.
Dolo,
Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
Thank you for this helpful explanation, your experience has much more value than me just trying to help based off pictures. I did mention I do not have experience with woma but I am always interested in learning more so thank you for sharing your experience.
-
The Following User Says Thank You to rufretic For This Useful Post:
-
Registered User
Re: Does this look like a woma fire yellowbelly
 Originally Posted by asplundii
Rufretic, Godzilla,
With respect, might I ask if either of you actually work with the Woma morph?
I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.
Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.
You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.
Dolo,
Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
I called and texted him yesterday. Haven't heard back. I'm pretty sure he wasn't the original breeder because he was selling 6 ball pythons. They were different gene snakes. I know 4 of them Fire Woma YB, Het Pied, Enchi G-Stripe and "Volta". He told me him and his wife wanted to sell the ball pythons and get into hognoses.
I posted this because when we met up something seemed off about him. When I started asking for background info on the "Volta" then all of sudden he remembered it was sold. I realize it wasn't the smartest move to purchase an animal off of Craiglist but I don't have any regrets. She's a great eater plus awesome to look at when I take her out.
Thank you guys for taking your time out posting.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|