Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,770

0 members and 1,770 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,097
Threads: 249,238
Posts: 2,572,918
Top Poster: JLC (31,651)
Welcome to our newest member, JoRyMe
Results 1 to 5 of 5
  1. #1
    Registered User PixilatedKhan's Avatar
    Join Date
    05-12-2019
    Posts
    4
    Thanks
    1
    Thanked 5 Times in 2 Posts

    Question about Co-Dominant genes

    I'm doing some preliminary research into ball python genetics and I see that a lot of designer morphs are different combinations of base co-dominant genes. For example the Freeway morph being a mix of yellow belly and asphalt. I'm wondering if there is a limiting factor on how many of these co-dominant genes can be combined, and if adding "super" variants changes anything. I know the odds of producing a baby with a specific set of genes goes up the more of them you combine, but does there appear to be an upper limit of combinations? Could you theoretically produce a snake that shows all co-dominant morphs, or would it be like mixing paint and all you get is one gene winning out above the rest? I know some combinations produce an all white or all black snake, but avoiding those is it possible? Sorry if any other post has asked this already, but it's been on my mind for a bit and I thought you guys(and gals) might have an answer.

    Sent from my SM-G965U using Tapatalk

  2. #2
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    Are their limits? no however the more you stack up the genes the less the animal truly becomes identifiable and the more you stack up the worse your odd of producing an animal with all the genes becomes.

    If you breed a 1 gene snake to a 1 gene your odds are 1/4
    If you breed a 4 genes snakes to a 4 genes snakes your odds are 1/256

    That said it's not impossible so far my best odds have been to hit on 1/64

    Super do give you better odds.

    .
    Deborah Stewart


  3. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    PixilatedKhan (05-15-2019)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The only real limit is that you cannot have more than two alleles from any complex - e.g., you cannot have a Bamboo/Lesser/Mojave or an Asphalt/Specter/YB - and you cannot have lethal combinations.

    There may be some point where you put enough mutations in to have a systemic deleterious effect but we do not seem to have hit that point yet. At least no one has reported it
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #4
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    As the others have said, there is not a limit of how many co-dominant morphs you can get in a single snake but the odds of hitting the larger numbers are greatly reduced. The other issue is like Debrah mentioned, once you get past 3 it becomes more and more difficult to identify exactly what morphs are actually in the snake. Not to mention it starts to become pointless because a lot of combinations start to become muddy and less attractive than a snake that may only have 2 or 3, at least in my opinion anyway.

  6. #5
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Question about Co-Dominant genes

    Quote Originally Posted by Deborah View Post
    ....

    If you breed a 1 gene snake to a 1 gene your odds are 1/4
    If you breed a 4 genes snakes to a 4 genes snakes your odds are 1/256

    ....
    Those odds are for recessive genes. The odds with codominant mutant genes are different.

    One gene pair:
    codominant mutant/normal (one mutant gene) x codominant mutant/normal (one mutant gene) -->
    1/4 super
    2/4 (= 1/2) codominant mutant/normal (one mutant gene)
    1/4 normal

    and
    codominant mutant/normal (one mutant gene) x normal (2 normal genes) -->
    1/2 codominant mutant/normal (one mutant gene)
    1/2 normal (2 normal genes)

    Lets say you mate a snake with two gene pairs, each pair a codominant mutant/normal (one mutant gene), to another snake with two gene pairs, each pair a codominant mutant/normal (one mutant gene). And the two gene pairs in the second snake are not the same as in the first snake. In other words:
    snake 1:
    gene pair 1 = codominant mutant/normal (one mutant gene)
    gene pair 2 = codominant mutant/normal (one mutant gene)
    gene pair 3 = 2 normal genes
    gene pair 4 = 2 normal genes

    snake 2:
    gene pair 1 = 2 normal genes
    gene pair 2 = 2 normal genes
    gene pair 3 = codominant mutant/normal (one mutant gene)
    gene pair 4 = codominant mutant/normal (one mutant gene)

    Odds of getting 4 codominant mutants in one baby is 1/24 = 1/16.

    Also linkage comes into play. Ball pythons have 18 pairs of chromosomes. By the time there are 19 known mutants, at least 2 are in the same chromosome pair. According to World of Ball Pythons, there are over 200 known mutants. The closer the 2 mutants the more difficult to get both together.
    Last edited by paulh; 05-17-2019 at 06:38 PM.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1