Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 953

1 members and 952 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,145
Posts: 2,572,375
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 2 of 2 FirstFirst 12
Results 11 to 19 of 19

Thread: A Mystery Snake

  1. #11
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    Quote Originally Posted by mdb730 View Post
    My enchi het clown looks exactly like yours, she came from a lazik line clown and I have a friend who has a het clown who is also very very bright. Sometimes the het influences the look of the snake.
    Interesting! I've been scouring the internet trying to find another Enchi that looks like her, with no luck. Would you be willing to post a photo of yours? I'd love to see her.

    - Charles Eye

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Mystery Snake

    Quote Originally Posted by Eye4Pythons View Post
    In other words, androgenesis results in super forms and since she only has one apparent super form, she only has that morph (if she is, in fact, a product of androgenesis). That's what I got from what you said, anyway. Is that about right or has my simplification overlooked something important?
    Sorry, looking back I did go a little "science lecture mode" there LOL. But yes, that is pretty much the punchline to it.


    Quote Originally Posted by Eye4Pythons View Post
    This is really fascinating. I wish I would have realized as much in my formative years. Oh well. Never too late to learn something new!
    A good policy to live by. I try to pick up something new every day, which is why I have a massive file of scientific articles taking up an enormous amount of file space on my computer LOL
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Eye4Pythons (04-12-2019)

  4. #13
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    That's quite alright. I'd rather see the more complicated answer, so I have more than just the "meat and potatoes" of it. Thanks for your help.

  5. The Following User Says Thank You to Eye4Pythons For This Useful Post:

    asplundii (04-09-2019)

  6. #14
    BPnet Veteran stoaob3's Avatar
    Join Date
    01-12-2013
    Posts
    305
    Thanks
    308
    Thanked 76 Times in 60 Posts

    Re: A Mystery Snake

    Mind what breeder I ask where she came from ?

    Sent from my Moto Z2 Play using Tapatalk

  7. #15
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    Quote Originally Posted by stoaob3 View Post
    Mind what breeder I ask where she came from ?

    Sent from my Moto Z2 Play using Tapatalk
    Milbradt & Caponetto Pythons.

    - Charles Eye

  8. #16
    BPnet Veteran stoaob3's Avatar
    Join Date
    01-12-2013
    Posts
    305
    Thanks
    308
    Thanked 76 Times in 60 Posts

    Re: A Mystery Snake

    Its head looks like my super Enchi yellow belly. Not saying that's what it is. Just looks similar except mines perfectly symmetrical. I have scene an Enchi like this when I was working at Garricks and was also het clown .... I'm willing to bet it had more than what it was Identified as

    Sent from my Moto Z2 Play using Tapatalk

  9. The Following User Says Thank You to stoaob3 For This Useful Post:

    Eye4Pythons (04-12-2019)

  10. #17
    BPnet Veteran stoaob3's Avatar
    Join Date
    01-12-2013
    Posts
    305
    Thanks
    308
    Thanked 76 Times in 60 Posts

    Re: A Mystery Snake

    Quote Originally Posted by Eye4Pythons View Post
    I recently purchased a new female to add to my extremely modest collection. She was advertised as an Enchi 100% het Clown. She looks like a Super Enchi to me (and to her breeder).

    Her parents are 1.0 OD Enchi het Clown and 0.1 visual Clown. I've talked to a few people about her and have been told she could be an Enchi Blade het Clown (meaning the breeder may not know he has some Blade in his collection). This seems like a perfectly reasonable explanation and I do plan to prove her out eventually but I thought I'd ask the rest of you what you thought, in the meantime.

    Whether she's got an extra gene or she's just the coolest looking Enchi I've ever seen, I'm very happy with her. I mean, look at her. She's gorgeous!

    Sent from my Moto G Play using Tapatalk
    Could be a super blade Enchi

    Sent from my Moto Z2 Play using Tapatalk

  11. The Following User Says Thank You to stoaob3 For This Useful Post:

    Eye4Pythons (04-12-2019)

  12. #18
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    Quote Originally Posted by stoaob3 View Post
    Could be a super blade Enchi

    Sent from my Moto Z2 Play using Tapatalk
    That would be fine by me. I've always been a fan of bonus features.

    - Charles Eye

  13. #19
    BPnet Veteran stoaob3's Avatar
    Join Date
    01-12-2013
    Posts
    305
    Thanks
    308
    Thanked 76 Times in 60 Posts

    Re: A Mystery Snake

    Can't go wrong with extra genes that weren't in the price BONUS

    Sent from my Moto Z2 Play using Tapatalk

  14. The Following User Says Thank You to stoaob3 For This Useful Post:

    Eye4Pythons (04-12-2019)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1