» Site Navigation
0 members and 650 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Registered User
-
The Following User Says Thank You to Eye4Pythons For This Useful Post:
-
Beautiful snake, I’m no expert by any means. But possibly something more then just Enchi. Looking forward to someone with more experience weighing in.
1.0 Black Pastel Pinstripe
1.0 Reduced Pattern Clown
1.0 Low White Pied
1.0 Hypo Super Enchi
-
The Following User Says Thank You to Sonny1318 For This Useful Post:
-
Certainly looks like a SuperEnchi... Possible this is a case of androgenesis. And if that is the case then she will also prove to not be het Clown
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Eye4Pythons (04-12-2019),Lord Sorril (04-05-2019)
-
Registered User
Re: A Mystery Snake
 Originally Posted by asplundii
Certainly looks like a SuperEnchi... Possible this is a case of androgenesis. And if that is the case then she will also prove to not be het Clown
See, I hadn't thought of that. I (with my incredibly basic understanding of such things) thought that androgenesis acted like parthenogenesis, except taking the genetics from the male instead of the female. If the father is an OD Enchi het Clown, how would he produce a baby that is Super Enchi and without the possibility of being het Clown?
Forgive my ignorance. I'm no geneticist by any means (which I'm beginning to feel is a failing on my part). I'm certainly looking to learn more, though.
- Charles Eye
-
-
Re: A Mystery Snake
It is also possible:
-The female Clown is a non-expressive Enchi.
-The Super Enchi is a result of retained sperm from the prior year.
-Or the breeder got his notes mixed up.
Although I like the Androgenesis theory. Sounds so much cooler!
-
The Following User Says Thank You to Lord Sorril For This Useful Post:
-
Re: A Mystery Snake
Scratch that 'Retained Sperm Theory' -- Can't make a Super Enchi without both parties being Enchi to start with.
-
-
Registered User
Re: A Mystery Snake
 Originally Posted by Lord Sorril
Scratch that 'Retained Sperm Theory' -- Can't make a Super Enchi without both parties being Enchi to start with. 
No but your other thoughts on the subject are sound. I would be quite happy to find out that her mother is just low expression. I know I've seen plenty of reduced Clowns for sale that looked very much like low expression Enchi Clowns. If HER breeder wasn't confident enough to call her an Enchi Clown, it's quite possible she was sold off as just a reduced Clown.
These kinds of things are a lot of fun for me. I get to enjoy the guessing game while I'm waiting to prove her out. I could have bought any number of Enchi het Clowns for my project but this girl has secrets to uncover and I want to be the one to do so. No matter what, she's gonna make some pretty babies!
- Charles Eye
-
-
Re: A Mystery Snake
 Originally Posted by Eye4Pythons
See, I hadn't thought of that. I (with my incredibly basic understanding of such things) thought that androgenesis acted like parthenogenesis, except taking the genetics from the male instead of the female. If the father is an OD Enchi het Clown, how would he produce a baby that is Super Enchi and without the possibility of being het Clown?
Forgive my ignorance. I'm no geneticist by any means (which I'm beginning to feel is a failing on my part). I'm certainly looking to learn more, though.
Unless it is purposeful, ignorance is nothing you need to ask forgiveness for. All of us have areas where we have strengths and areas where we have weaknesses. Acknowledging ignorance is just taking the first step to learning. So I applaud you for not just recognizing where you are weak but looking to change that by learning. That is something to be proud of, not apologize for.
Now... To answer your question.
If the sire was an Enchi OD het Clown then genetically he would be EeOoCc. During gametogenesis, the genetic payload in the sperm contain only one copy of each chromosome, ergo only one copy of each gene. This means that the possible sperm from the father are:
EOC
EOc
Eoc
EoC
eOC
eOc
eoc
eoC
When androgenesis happens, the sperm (typically) penetrates an egg that has no genetic payload and the first act that occurs is an automatic doubling of the sperm's genetic package. This makes the embryo homozygous for whatever genes it is carrying. So if the sperm had carried the Clown gene then a homozygous embryo would, of course, be a visual Clown. Because your animal is not a visual Clown (and assuming androgenesis is at play here) then we know that the sperm responsible was not carrying the Clown gene. Likewise, because your animal is not a SuperOD we know the sperm did not carry the OD gene. This means the sperm was EoC, which when doubled makes EEooCC - homozygous Ench at Enchi locus, homozygous WT at OD locus, and homozygous WT at Clown locus.
Make sense?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Eye4Pythons (04-12-2019),pbenner (04-08-2019)
-
BPnet Veteran
Re: A Mystery Snake
My enchi het clown looks exactly like yours, she came from a lazik line clown and I have a friend who has a het clown who is also very very bright. Sometimes the het influences the look of the snake.
-
The Following 3 Users Say Thank You to mdb730 For This Useful Post:
Eye4Pythons (04-12-2019),Godzilla78 (04-05-2019),Ronniex2 (04-08-2019)
-
Registered User
Re: A Mystery Snake
 Originally Posted by asplundii
Unless it is purposeful, ignorance is nothing you need to ask forgiveness for. All of us have areas where we have strengths and areas where we have weaknesses. Acknowledging ignorance is just taking the first step to learning. So I applaud you for not just recognizing where you are weak but looking to change that by learning. That is something to be proud of, not apologize for.
Now... To answer your question.
If the sire was an Enchi OD het Clown then genetically he would be EeOoCc. During gametogenesis, the genetic payload in the sperm contain only one copy of each chromosome, ergo only one copy of each gene. This means that the possible sperm from the father are:
EOC
EOc
Eoc
EoC
eOC
eOc
eoc
eoC
When androgenesis happens, the sperm (typically) penetrates an egg that has no genetic payload and the first act that occurs is an automatic doubling of the sperm's genetic package. This makes the embryo homozygous for whatever genes it is carrying. So if the sperm had carried the Clown gene then a homozygous embryo would, of course, be a visual Clown. Because your animal is not a visual Clown (and assuming androgenesis is at play here) then we know that the sperm responsible was not carrying the Clown gene. Likewise, because your animal is not a SuperOD we know the sperm did not carry the OD gene. This means the sperm was EoC, which when doubled makes EEooCC - homozygous Ench at Enchi locus, homozygous WT at OD locus, and homozygous WT at Clown locus.
Make sense?
In other words, androgenesis results in super forms and since she only has one apparent super form, she only has that morph (if she is, in fact, a product of androgenesis). That's what I got from what you said, anyway. Is that about right or has my simplification overlooked something important?
This is really fascinating. I wish I would have realized as much in my formative years. Oh well. Never too late to learn something new!
- Charles Eye
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|