Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 778

0 members and 778 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,904
Threads: 249,099
Posts: 2,572,073
Top Poster: JLC (31,651)
Welcome to our newest member, GeneticArtist
Results 1 to 5 of 5
  1. #1
    Registered User
    Join Date
    03-06-2019
    Posts
    13
    Thanks
    4
    Thanked 8 Times in 4 Posts

    Picking up my new "lesser g stripe" tmrw! Plus a question.

    I've got a 4 year old lesser g stripe on hold at my favorite local pet store and I'm bringing him home tomorrow! Normally I don't get my balls from a store but he's beautiful and they take care of their snakes. I often stop in to see what they've got and talk herp with the employees. I've never seen a live representation of these morphs together but on the genetic wizard they're shown in the pics on there with a full stripe , no pattern, and just the color of the lesser. He's got his lesser pattern all the way down his body plus the caramel color, and the stripe only goes down his back half and is a creamy sorry of color.

    Wondering if anyone has seen these two morphs together or knows anything about how genetic stripe presents with lesser? I'm curious if I'm over paying for a unique lesser. Will post pics tomorrow. If anyone has pics of one I'd like to see them.
    Last edited by E-squirrel; 04-02-2019 at 11:32 PM.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    GStripe Lessers are very distinct: Patternless laterals and a very boldly outlined dorsal stripe that is almost always complete from head to tail.

    http://www.worldofballpythons.com/mo...stripe-lesser/
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User
    Join Date
    03-06-2019
    Posts
    13
    Thanks
    4
    Thanked 8 Times in 4 Posts
    Went in to talk to them and see about the parents and learned only that they have a severe misunderstanding of what co-dom and recessive are. Unfortunately I know more than they do and can't confirm that he's even het for g stripe. Looking at his pattern after some research he's straight lesser visual. The answer at the pet store was, "sometimes genetic stripe shows up, sometimes it doesn't but if you breed it you will definitely get some true genetic stripe babies.".

    Clearly not true. Given that I couldn't get any info on the parents I suppose there's a 1 in 100 chance he's got it. So while he's a pretty lesser, I'm not a gambler. No lesser het g stripe for me.

    Thanks for the advice!

  4. #4
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    i have a Butterbee G-Stripe and a Banana G-Stripe.

    yeah, i would pass also. sounds like from your description, they went from Lesser G-Stripe to Lesser het G-Stripe to who knows what we have.

    G-Stripes look awesome tho. i hope u can join the club one day and scoop one up.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  5. #5
    Registered User
    Join Date
    03-06-2019
    Posts
    13
    Thanks
    4
    Thanked 8 Times in 4 Posts

    Re: Picking up my new "lesser g stripe" tmrw! Plus a question.

    My mission is a lesser/Mojave leuzistic once my mojave/pastel is big enough to breed. But I figured I also want to start a recessive project after that so why not get the stripe! Plus they do look fantastic. Anyways I'm hoping I see some cool lesser combos at the expo this Saturday. I'll have to get lucky, though. There was only one male lesser last time I was there. (Grand Rapids doesn't have the biggest reptile expo ever, but it's monthly)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1