Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 651

0 members and 651 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,102
Posts: 2,572,091
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 6 of 6
  1. #1
    Registered User
    Join Date
    03-21-2019
    Posts
    5
    Thanks
    17
    Thanked 0 Times in 0 Posts

    Exclamation -VIDEO SERIES- documenting PARTHENOGENESIS "virgin birth" of Mr. Lund's Ball Python.

    Parthenogenesis is a mode of asexual reproduction in which offspring are produced by females without the genetic contribution of a male.

    I was lucky enough to stumble across a science professor by the name of Mr.Lund who's average ball python, preformed an extraordinary act.

    Maybe you've read an article, or heard about it from a friend.
    BUT, have you ever seen a video series documenting a case of ball python parthenogenesis every step of the way?

    Mr. Lund's series currently consist of 10 episodes, I must warn you, this roller coaster has major ups and downs.

    https://www.youtube.com/watch?v=d48bNidrPss



  2. #2
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,877
    Thanks
    842
    Thanked 4,046 Times in 1,482 Posts
    Images: 120

    Re: -VIDEO SERIES- documenting PARTHENOGENESIS "virgin birth" of Mr. Lund's Ball Pyth

    No one on YouTube would ever give false information for views...
    *.* TNTC

  3. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Bogertophis (04-01-2019)

  4. #3
    Registered User
    Join Date
    03-21-2019
    Posts
    5
    Thanks
    17
    Thanked 0 Times in 0 Posts

    Re: -VIDEO SERIES- documenting PARTHENOGENESIS "virgin birth" of Mr. Lund's Ball Pyth

    Quote Originally Posted by Lord Sorril View Post
    No one on YouTube would ever give false information for views...
    What views? He barely has any. Take a look at his other content, does he look like the type of person who would do that sort of thing?

    Did you even bother to watch the videos?
    Last edited by DerrickRyan; 03-29-2019 at 06:06 AM.

  5. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    Well the first 2 mins were pretty boring and with misinformation.

    Talking about female egg production in general when paired with a male
    so it happen sometimes that they lay one slug, or a clutch of good eggs and one slug but all slugs are rare and unheard off
    .....WRONG female slug out and it's far from being uncommon.

    Overall I had to watch because I need to make sure it does not violates TOS but it's pretty boring I could not imagine having to watch 9 more.

    Parthenogenesis while rare can be explained in a 10 min video from egg discovery to hatching.
    Last edited by Stewart_Reptiles; 03-29-2019 at 12:14 PM.
    Deborah Stewart


  6. The Following 5 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Bogertophis (04-01-2019),Lord Sorril (03-29-2019),pbenner (03-29-2019),pretends2bnormal (03-29-2019),Toad37 (03-29-2019)

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: -VIDEO SERIES- documenting PARTHENOGENESIS "virgin birth" of Mr. Lund's Ball Pyth

    Quote Originally Posted by Deborah View Post
    Well the first 2 mins were pretty boring and with misinformation.
    The fact that he totally skipped over the entire body of Dr. Booth's work on parth but instead cited an obscure paper from an even more obscure publication was the point where I officially turned off...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (04-01-2019)

  9. #6
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,782
    Thanks
    29,337
    Thanked 20,554 Times in 12,280 Posts

    Re: -VIDEO SERIES- documenting PARTHENOGENESIS "virgin birth" of Mr. Lund's Ball Pyth

    Quote Originally Posted by Deborah View Post
    .....WRONG female slug out and it's far from being uncommon...
    FWIW, years ago I took in an unwanted rosy boa from a nature museum who had in the past "freaked out the staff" when she dropped a bunch of slugs, & who then
    went on to do the same thing with me several months later, with the exception that for me she included one live imperfect neonate that lived about 6 mos.- & which
    had apparently been produced by parthenogenesis.

    This thread caught my eye but I didn't have time to watch it yet...thanks to those who saved me the trouble.

  10. The Following User Says Thank You to Bogertophis For This Useful Post:

    CloudtheBoa (04-01-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1