» Site Navigation
3 members and 1,077 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,144
Posts: 2,572,366
Top Poster: JLC (31,651)
|
-
Sahara Breeders?
Anyone know of any breeders working with the gene? Can’t find much on it.
Sent from my iPhone using Tapatalk
-
-
Re: Sahara Breeders?
A search on morph market has only a few results, all from one place, called Breeder's Circle. You could try looking into them
-
-
Re: Sahara Breeders?
Yeah that’s the only place I can find as well. Just hets from what I can see.
Sent from my iPhone using Tapatalk
-
-
Re: Sahara Breeders?
Yea looks like it :/
Pick some up and produce some for us, will ya?!
-
-
Given Sahara is just DesertGhost by another name you can significantly open your pool of animals by looking at the DG results
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Sahara Breeders?
 Originally Posted by asplundii
Given Sahara is just DesertGhost by another name you can significantly open your pool of animals by looking at the DG results
The way I understand it they are different morphs. Sahara has a super form that creates a solid white snake. Is there a super orange ghost?
Sent from my iPhone using Tapatalk
-
-
Re: Sahara Breeders?
 Originally Posted by Jbabycsx
The way I understand it they are different morphs. Sahara has a super form that creates a solid white snake. Is there a super orange ghost?
You cannot have a superform of a recessive genetic trait, genetics does not work that way. The alleged superform was an Ivory, the two Saharas that produced it were both Sahara YB.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Sahara Breeders?
Ahhh ok. That’s the part I was missing. I didn’t read the part about both parents carrying YB.
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|