» Site Navigation
0 members and 1,665 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,090
Threads: 249,228
Posts: 2,572,846
Top Poster: JLC (31,651)
|
-
Registered User
Why is the leopard gene more dominant than others?
Hi!
something I’ve been curious about for a while is why the leopard pattern tend to show up stronger while breeding than other patterns? Like take ivory leopard for example and how it show up in the ivory. Like if I bred a black pastel with an ivory or some other more patterned type snake it doesn’t seem as it shows up as much... any ideas?
-
-
-
The Following 2 Users Say Thank You to Lord Sorril For This Useful Post:
Dianne (02-17-2019),Reinz (02-16-2019)
-
Re: Why is the leopard gene more dominant than others?
Some morphs are minor mutations, while some are dramatic and vivid.
Leopard is one of the vivid morphs
Sent from my iPhone using Crapatalk.
-
-
BPnet Veteran
Leopard is a pattern and color mutation. The leopard tends black in the pattern.
So for your Leopard Ivory example. The Leopard changes the pattern in the Ivory, which would usually go unnoticed since the Ivory is such a strong color mutation. However, since the leopard adds "black" to the patter, think darkness, this is why the purple patterns POPS in a Leopard Ivory...
.... I think.
Joe
#1 Lurker...
working with Phantom, Black Head, Cypress, Special, Lesser, Het Daddy, Leopard, Spotnose, YB, OD, Hypo, Desert Ghost and Clown.
-
-
Registered User
Re: Why is the leopard gene more dominant than others?
Thanks everyone for awesome responses!
-
-
Re: Why is the leopard gene more dominant than others?
 Originally Posted by lovepig78
Leopard is a pattern and color mutation. The leopard tends black in the pattern.
So for your Leopard Ivory example. The Leopard changes the pattern in the Ivory, which would usually go unnoticed since the Ivory is such a strong color mutation. However, since the leopard adds "black" to the patter, think darkness, this is why the purple patterns POPS in a Leopard Ivory...
.... I think.
It is more accurate to say that Leopard (and also YB) are pigment distribution mutants and that Leopard returns a level of pigment distribution to the large-scale removal that Ivory causes. This return of distribution generates the shadowing you see in the Ivory Leo
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|