Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 716

0 members and 716 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,102
Posts: 2,572,091
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 1 of 2 12 LastLast
Results 1 to 10 of 11
  1. #1
    BPnet Veteran
    Join Date
    09-13-2017
    Posts
    594
    Thanks
    1,160
    Thanked 507 Times in 292 Posts

    Calling all dumeril boa owners

    Hello my friends! Been researching the Dumeril Boa as my next purchase. I have found a 3 month old male Dumeril boa that I have my eye on, but I wanted to take a moment and ask all of you current Dumeril boa owners to share the Good, Bad and Ugly facts about this type of boa. Thanks in advance



  2. #2
    BPnet Lifer redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,525
    Thanks
    1,968
    Thanked 4,018 Times in 1,743 Posts
    Images: 5
    I have a 6 year old female who is 6 feet long. She's always been very easy to care for, easy to handle, docile, and easy to feed since I bought her at 2 years old. They are burrowing snakes and love to burrow as deep as the substrate you provide them. They drink a lot of water. They're nice and straightforward snakes, and a good size. Very sedentary species, they tend to just chill on the couch or lay in your lap and stay there.

    I don't think there is any "bad/ugly" really!
    Last edited by redshepherd; 11-26-2018 at 09:26 PM.




  3. The Following 4 Users Say Thank You to redshepherd For This Useful Post:

    Bogertophis (11-27-2018),distaff (11-27-2018),Jus1More (11-26-2018),MissterDog (11-26-2018)

  4. #3
    BPnet Veteran WhompingWillow's Avatar
    Join Date
    03-24-2018
    Location
    Northern MN
    Posts
    791
    Thanks
    338
    Thanked 1,237 Times in 501 Posts
    Images: 3

    Re: Calling all dumeril boa owners

    They're amazing snakes. We got Memphis as a juvenile (she's probably a late 2017 snake) maybe 6 or so months ago, and she's just awesome. Fairly straightforward husbandry. Docile. A nice mix betwee lazy and active in her cage. Content to chill when out.

    The only potential thing to be cautious of that I can think of is to be sure you're getting a decent eater. I have not personally experienced any feeding difficulty with Memphis (she's never missed a meal and we've only ever given her F/T rats. She begs for food, lol) but I've heard that Dums can be notoriously finicky eaters as hatchlings.

    But you should definitely consider one! They're very underrated in my opinion.
    BALL PYTHONS: 1.0 Pied/Clark, 1.0 Pastel Vanilla Super Stripe/Sunny, 0.1 Dragon Fly/Buffy, 0.1 Pastel Vanilla Yellow Belly/Cher, 0.1 BEL (Mojave Lesser)/Arya, 0.0.1 Normal/Norm, 0.1 Cinnamon Enchi/Peaches, 1.0 Cinnamon Calico/Yoshi, 0.1 Pewter Het Dreamsicle/Ariel
    BOAS: 0.1 Dumeril's/Memphis, 0.1 BCL/Artemis, 1.0 BCO/Grimm, 0.1 Suriname BCC/Rhubarb
    CORN SNAKES: 0.0.1/Mushu
    MORELIA: 0.1 Bredli/Zelda, 0.1 Granite IJ/Bridget, 0.1 Caramel Diamond Jungle/Pixie

  5. The Following 3 Users Say Thank You to WhompingWillow For This Useful Post:

    Bogertophis (11-27-2018),distaff (11-27-2018),Jus1More (11-26-2018)

  6. #4
    BPnet Veteran Phillydubs's Avatar
    Join Date
    02-04-2018
    Posts
    1,285
    Thanks
    510
    Thanked 1,244 Times in 667 Posts
    You already got some great advice above and I would echo what was said

    I love mine and he’s a great snake always out to see. Loves to burrow. Very bossy when I’m in the room. Just a cool dude.

    Ive heard as well that they can be tough to get states on food.

    Also choose wisely because at first glance they may all seem the same. But I’ve seen very light colored ones with pinks and oranges etc and I’ve seen some drab dark muddied browns and blacks. I wanted a brighter one so I passed on a few until I found my guy
    1.0 - Cinnamon Banana Ball Python (Thunder)
    1.0 - Yellow Belly High White Pied Ball Python (Pretty Fly For A White Guy)
    0.1 - Cinnamon GHI Ball Python (Leslie Snipes)
    1.0 - Dumerils Boa (Sushi)
    0.1 - Caye Caulker Boa (Lady Liberty)
    0.0.? - Mandarin Rat Snake (Bumble)
    1.0 - Mexican Black King (Rico Suave)
    1.0 - Black Tail Cribo (Goldar)
    0.1 - Jaguar Carpet Python (Cookie)
    1.0 - Vietnamese Blue Beauty (Elsa)
    1.0 - Green Tree Python (Banner)
    0.2 - Yellow/Quince Monitors (Blanche & Dorothy)

  7. The Following 2 Users Say Thank You to Phillydubs For This Useful Post:

    Bogertophis (11-27-2018),Jus1More (11-26-2018)

  8. #5
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts
    Mine was purchased as a baby. There are no morphs, per se, as far as I know but there are bloodlines. These bloodlines give them an appearance that can be more pink, less stripes, etc. They are a little more expensive and can be difficult to spot as a newbie because the differences can be vague. Regardless, a normal looks gorgeous on its own and pictures do not do it justice. If you have to hold one to understand the beauty and texture of its smooth skin. It is almost like admiring a living expensive handbag..

    Anyways, if you have experience with ball pythons, I would recommend them as a step up snake or boa alternative to the BCC and BCI that you see commonly everywhere. There is a level of humidity to maintain like a bp. They prefer cooler temps (low 80's) and deep enough substrate to burrow and hide in. Mine has 2 hides but will always prefer to burrow. One of main reasons why I think they are a step up is due to their picky eating. Like a bp but much more shy than a bp. If your husbandry is off, they won't eat. If they are not happy with something, they won't eat. Some owners even resort to using baby chicks to get them to feed. Mine ate f/t at the start. Then, he decided not to. I had to go down the ladder so to speak and go back down in size and feeding live to get him to eat before slowly switching back to f/t.

    I find that it is less about the type of prey but rather just their shy nature taking a bigger toll on them than a bp would be. So if you have dealt with a picky eater before, and you have worked with bps, you will be fine.

  9. The Following 2 Users Say Thank You to Cheesenugget For This Useful Post:

    distaff (11-27-2018),Jus1More (11-27-2018)

  10. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    My only warning is that mine can be a bit food aggressive. So have a hook or paper towel roll handy whenever you open the cage so that you can break any feed response your animal might have. They also prefer to be kept a bit cooler so I do not advocate cranking them with a 90F hot spot. Other than that, I would pretty much agree with everything previously mentioned.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    distaff (11-27-2018),Jus1More (11-27-2018)

  12. #7
    Registered User boidavid's Avatar
    Join Date
    10-06-2015
    Posts
    28
    Thanks
    15
    Thanked 57 Times in 21 Posts

    Re: Calling all dumeril boa owners

    My 5 year old boy Champ is just an awesome snake. He has never given me cause for concern in any way. He eats, sheds, and does everything else like he's supposed to. I keep him at low to mid eighties warm and low to mid seventies cool with 65-75 % humidity in a deep substrate of 100% cypress mulch. Favorite snake to handle and favorite to look at, when he's visible, lol!

    Sent from my 5049Z using Tapatalk

  13. The Following 2 Users Say Thank You to boidavid For This Useful Post:

    distaff (11-27-2018),Jus1More (11-27-2018)

  14. #8
    Registered User
    Join Date
    07-29-2018
    Posts
    28
    Thanks
    21
    Thanked 36 Times in 18 Posts
    I got mine as a rescue. She was abandoned by her previous owner, and I took her in.

    She wouldn't eat at first, but her husbandry had been way off. She had no heat source, nothing to burrow in. Just a water bowl.

    I got her in a nice enclosure, belly heat at 85 on one side, and heat lamps on the other side, one lamp for day, and one lamp for night. The night light is a black light of a lower wattage than the day light, to give her a night time temp drop. I use aspen bedding for her to burrow in, and I gave her hides on both sides.

    She LOVES this setup, after one week, she started eating again, and hasn't slowed down since.

    She's a very agressive feeder, but completely docile when she's being handled. An absolutely great pet snake

    Last edited by Fastfish; 11-28-2018 at 09:41 PM.

  15. The Following User Says Thank You to Fastfish For This Useful Post:

    Jus1More (11-28-2018)

  16. #9
    BPnet Veteran
    Join Date
    09-13-2017
    Posts
    594
    Thanks
    1,160
    Thanked 507 Times in 292 Posts

    Re: Calling all dumeril boa owners

    WOW!! Thank you everyone for all the wonderful replies. It seems that dumerils are a favorite to some and I am glad to hear that they are good natured snake as well. I really did not hear anyone with negative feed back except that they are food aggressive, which most boa's are. I found a local breeder here in Toronto and paid them a visit today to see the dumerils they had. OMG! Talk about gorgeous, the patterns on them were stunning. There were only 3 of them left and all about 3 months old. It did not take me long to pick out the one I was drawn to which just happened to be a precious little boy. I handled him for awhile and was amazed just how docile and relaxed he was, even at that age. I was happy with my choice and will be able to bring him home either tomorrow or Friday. I can't wait as I am excited to add him to my family of reptiles. I will most definitely let everyone know when he is home safely and post a picture of him.

    Thank you again my friends for sharing all of your stories about these beauties.
    Last edited by Jus1More; 11-28-2018 at 10:24 PM.



  17. The Following 3 Users Say Thank You to Jus1More For This Useful Post:

    Dianne (11-28-2018),Fastfish (11-29-2018),hilabeans (11-29-2018)

  18. #10
    BPnet Veteran WhompingWillow's Avatar
    Join Date
    03-24-2018
    Location
    Northern MN
    Posts
    791
    Thanks
    338
    Thanked 1,237 Times in 501 Posts
    Images: 3

    Re: Calling all dumeril boa owners

    Congrats and welcome to the club! Can't wait to see photos!
    BALL PYTHONS: 1.0 Pied/Clark, 1.0 Pastel Vanilla Super Stripe/Sunny, 0.1 Dragon Fly/Buffy, 0.1 Pastel Vanilla Yellow Belly/Cher, 0.1 BEL (Mojave Lesser)/Arya, 0.0.1 Normal/Norm, 0.1 Cinnamon Enchi/Peaches, 1.0 Cinnamon Calico/Yoshi, 0.1 Pewter Het Dreamsicle/Ariel
    BOAS: 0.1 Dumeril's/Memphis, 0.1 BCL/Artemis, 1.0 BCO/Grimm, 0.1 Suriname BCC/Rhubarb
    CORN SNAKES: 0.0.1/Mushu
    MORELIA: 0.1 Bredli/Zelda, 0.1 Granite IJ/Bridget, 0.1 Caramel Diamond Jungle/Pixie

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1