» Site Navigation
1 members and 817 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,103
Posts: 2,572,095
Top Poster: JLC (31,651)
|
-
Registered User
Does this look like a woma fire yellowbelly
I've been looking for some yellowbelly multi genes. I came across this guy on craigslist selling him. I've not seen him in person.
Last edited by Dolo; 10-04-2018 at 04:16 PM.
-
The Following User Says Thank You to Dolo For This Useful Post:
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by Dolo
I've been looking for some yellowbelly multi genes. I came across this guy on craigslist selling him. I've not seen him in person. 
I don’t know what that is, but it’s awesome! How much??? I will buy it and pay for shipping too! Hook a brother up!
-
-
Registered User
Late update. I did purchase the animal. It turned out to be a female. But, I think it's actually a Super Enchi Woma. BHB has produced some and she looks like them. https://www.morphmarket.com/us/searc...y=&layout=grid
If anyone sees something different please let me know.
-
The Following User Says Thank You to Dolo For This Useful Post:
-
I do not see Enchi in that animal. Enchi enhances the expression of the yellow pigment, SuperEnchi even more so, and you do not see any of that. I would believe it was a Fire Woma YB or just a high quality Fire Woma
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Thank you for your reply asplundii. I hope your right. I'm most likely going to breed her to an Ivory Pastel. Keeping her regardless. Her pattern is awesome.
-
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by asplundii
I do not see Enchi in that animal. Enchi enhances the expression of the yellow pigment, SuperEnchi even more so, and you do not see any of that. I would believe it was a Fire Woma YB or just a high quality Fire Woma
On most enchi combos I agree with you but out of the enchi woma and super enchi womas I've seen, it doesn't seem to have that same yellowing effect, they stay more of a brown tan. On this animal the pattern is just so reduced, I would think it had enchi if not super enchi. Because of its light color and blushed head stamp I do believe it has fire. What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me. My guess for this animal is enchi woma fire, possibly super enchi woma fire. But I think your going to need to breed her to be positive on anything other than woma.
OP, can you get side and belly pics? I think it could help determine if yellow belly is in there.
-
The Following User Says Thank You to rufretic For This Useful Post:
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by Dolo
Late update. I did purchase the animal. It turned out to be a female. But, I think it's actually a Super Enchi Woma. BHB has produced some and she looks like them. https://www.morphmarket.com/us/searc...y=&layout=grid
If anyone sees something different please let me know.
I agree, it looks definitely like a super enchi woma. Very nice.
-
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by rufretic
On most enchi combos I agree with you but out of the enchi woma and super enchi womas I've seen, it doesn't seem to have that same yellowing effect, they stay more of a brown tan. On this animal the pattern is just so reduced, I would think it had enchi if not super enchi. Because of its light color and blushed head stamp I do believe it has fire. What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me. My guess for this animal is enchi woma fire, possibly super enchi woma fire. But I think your going to need to breed her to be positive on anything other than woma.
OP, can you get side and belly pics? I think it could help determine if yellow belly is in there.
I concur. Definite super enchi woma with that awesome reduction! And the color tone on the head makes me think possibly fire gene as well
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
-
Registered User
-
-
Re: Does this look like a woma fire yellowbelly
 Originally Posted by Dolo
I'll start out by saying, I'm not great at spotting yellow belly in combos, especially ones I'm not familiar with but I have been doing a lot of research on it because it's a very useful gene and I've been trying to work more of it into my projects. But this is just my opinion based on what I've learned.
The belly shot would have me saying no yellow belly. It's way too clean and most combos with yellow belly have a checkering on the edges of the belly. Now because this woma is so reduced in pattern, I'm not sure how that would affect this checkering I'm talking about. I did find one yellow belly woma belly shot and it did have the checkering but this snake was not near as reduced as yours so I'm not 100% sure.
The side shot looks promising to me. Yellow belly tends to have yellow speckling working it's way up the sides giving almost a pixelated look. I'd say yours has that but looking at other womas, they all seem to have a bit of this so it's possible it's just the woma giving that look.
So overall, my guess would be no yellow belly. This certainly isn't a sure thing as far as I'm concerned but if I had to guess one way or the other, the belly is just too clean so I'd say no yellow belly.
If I were you, I'd still plan on breeding her with something that would prove one way or the other but could still produce combos you'd be happy with even if the yellow belly isn't present. One thought I had would by an ivory. You'll get ivories if she has yb so she'd be easily proved out but even if she doesn't you would now positively have yb in the hatchlings so you could end up with what your looking for anyway, you'd just need to take some time to grow it out.
Hope that was helpful.
Good luck!
Last edited by rufretic; 05-26-2019 at 10:46 AM.
-
The Following User Says Thank You to rufretic For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|