Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,140

2 members and 2,138 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,079
Threads: 249,221
Posts: 2,572,814
Top Poster: JLC (31,651)
Welcome to our newest member, Snaketammer28
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 22
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: "Look but don't touch" animals?

    Quote Originally Posted by redshepherd View Post
    As for other species of snakes, there are definitely snakes that are never comfortable with handling, or they are very hard to work with to tame if they have a strong tendency to bite all the time, always get very stressed out, etc so it makes it not worth the effort anyway and is hard on the snake. Not all animals can become pets that you can eventually handle.
    ^^^^
    This


    I have a pair of kukri snakes. If you know how they got their name you will understand why they are not 'touchy-feely' animals. I also have a pair of Rhamphiophis, a little research into them should explain why I do not handle them overly much either.

    I did not pick up these species so I could hold them and play with them (I have ball pythons if I want to do that), I got them because I wanted something unique/different to work with. I knew I would not be handeling them and I was perfectly happy with that
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (09-11-2018),Bogertophis (09-11-2018)

  3. #12
    BPnet Veteran Darkbird's Avatar
    Join Date
    11-29-2012
    Location
    Jackson, Mi
    Posts
    702
    Thanks
    131
    Thanked 284 Times in 202 Posts
    Images: 2
    Pretty much all young reptiles, and likely most animals of any sort, come pre-programmed with a response of "GIANT SCARY THING GONNA EAT ME!" in their brains, and it takes time and patience to teach them otherwise. And balls, with some exceptions, normally get past this fairly quickly and with a minimal nuber of puncture wounds to the owner, lol. There are of course many reptiles that stay defensive all their lives, most arboreal snakes come to mind, as well as a lot of smaller species of lizards.
    Where are we going, and why am I in this handbasket?

    Never argue with idiots. They will drag you down to their level and beat you with their experience.
    Artificial intelligence is no match for natural stupidity.

  4. The Following User Says Thank You to Darkbird For This Useful Post:

    Bogertophis (09-11-2018)

  5. #13
    Registered User wolftrap's Avatar
    Join Date
    08-27-2018
    Location
    Fort Worth, Texas
    Posts
    90
    Thanks
    24
    Thanked 75 Times in 42 Posts

    Re: "Look but don't touch" animals?

    Quote Originally Posted by Dianne View Post
    As everyone else has mentioned, time and gentle handling will prevail. Babies particularly can be flighty...imagine a huge hand lifting the roof and scooping you out of your living room.

    You also mentioned a ten gallon enclosure. If this is a glass tank, she could be over-stimulated with movement in the room. If her enclosure is glass, you may want to temporarily cover three sides to give her more privacy.
    Her enclosure is on a desk up against the wall; which three sides should I cover?

  6. #14
    Registered User
    Join Date
    11-21-2014
    Posts
    57
    Thanks
    65
    Thanked 33 Times in 22 Posts

    Re: "Look but don't touch" animals?

    Quote Originally Posted by wolftrap View Post
    Her enclosure is on a desk up against the wall; which three sides should I cover?
    If you are against the wall only on one side I would cover the two other sides that are perpendicular to the wall.

  7. The Following User Says Thank You to ryu80 For This Useful Post:

    Bogertophis (09-16-2018)

  8. #15
    BPnet Veteran Dianne's Avatar
    Join Date
    08-26-2018
    Location
    Virginia
    Posts
    1,298
    Thanks
    3,873
    Thanked 1,606 Times in 907 Posts
    Images: 17

    Re: "Look but don't touch" animals?

    Quote Originally Posted by ryu80 View Post
    If you are against the wall only on one side I would cover the two other sides that are perpendicular to the wall.
    Exactly...basically just leave the front area ‘open’ for viewing.

  9. #16
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,961
    Thanks
    29,650
    Thanked 20,754 Times in 12,421 Posts

    Re: "Look but don't touch" animals?

    Quote Originally Posted by wolftrap View Post
    ... some people say that even though they've worked with their animals their snake has become a "look but don't touch" sort of pet, where they limit handling because the animal is clearly not cut out for human interaction. However, others say that if you work with an animal enough at a patient, respectful speed, all animals can become pets that you can eventually handle.....
    The thing is that we're all different AND our snakes have their own personalities too: some of us are undoubtedly better or more persistent & patient about handling
    snakes, and some of our snakes -no matter what kind- are more receptive to being handled than even their own siblings. It comes down to both "nature" & "nurture".

    Some members of any given species will naturally respond better to handling & be able to overcome their instincts than others, and some of us give up sooner than
    others. Just because someone claims a snake is a "look but don't touch" pet doesn't mean that someone else might not have better luck. I've taken in many such
    snakes that bit former owners but not me, but if you're happy with a snake that is "display only" that's OK too. It's not as if the snake will complain, but my personal
    philosophy about keeping snakes (or any other wild animal in captivity) is that I don't want them to live in fear of the "unknown" -that's us, the big scary creatures that
    keep lurking about their cage.

    So I do all I can to convey to them that they have nothing to fear: that's the reason that I want to handle a snake. An animal living in fear & feeling cornered is bound
    to be more stressed, & that has an adverse effect on their health. Snakes clearly learn & remember they are safe with me as I don't handle them that often, but it's
    not unlike their survival in the wild: they learn their way around, where to hide from predators & bad weather or else they perish. Likewise, they learn that I'm just a
    safe part of their world & not going to eat them if I pick them up. There are some snakes that truly stay hysterical about human contact, unfortunately, & sometimes
    we have to accept that...but we might all draw that line in a different place.

  10. The Following 3 Users Say Thank You to Bogertophis For This Useful Post:

    EL-Ziggy (09-13-2018),Tessellate (09-11-2018),wolftrap (09-12-2018)

  11. #17
    Registered User wolftrap's Avatar
    Join Date
    08-27-2018
    Location
    Fort Worth, Texas
    Posts
    90
    Thanks
    24
    Thanked 75 Times in 42 Posts

    Re: "Look but don't touch" animals?

    Quote Originally Posted by Dianne View Post
    Exactly...basically just leave the front area ‘open’ for viewing.
    I can definitely do that - I've covered the side that faces the doorway so that the door opening/us walking in/dogs walking in wouldn't alarm her as much, but I'll try covering the other two sides.

  12. The Following User Says Thank You to wolftrap For This Useful Post:

    Bogertophis (09-12-2018)

  13. #18
    BPnet Veteran Dianne's Avatar
    Join Date
    08-26-2018
    Location
    Virginia
    Posts
    1,298
    Thanks
    3,873
    Thanked 1,606 Times in 907 Posts
    Images: 17

    Re: "Look but don't touch" animals?

    Quote Originally Posted by wolftrap View Post
    I can definitely do that - I've covered the side that faces the doorway so that the door opening/us walking in/dogs walking in wouldn't alarm her as much, but I'll try covering the other two sides.
    Best of luck! I’m also tweaking setups for new baby balls...it’s almost a right of passage as you learn your snake’s preferences. Two of the three hatchlings I purchased this year are very confident, but my lemonblast (Belle) has been more reluctant to feed and much more shy/skittish than the others. I switched cages around so that she is on the top of my stack so she sees little to no movement unless I’m peeking in from a stepstool. I wasn’t handling her other than to move the hide to check on her well-being, but I’ve eliminated all handling unless I’m cleaning the cage. She’s taken her second large fuzzy/small hopper tonight. It’s taken a little over a month, but she’s settling in, feeding now, and doesn’t appear as startled when I do check in on her. It takes time, but with continued calm interactions they do come around. Patience is the hardest part...speaking for myself anyway.

  14. The Following User Says Thank You to Dianne For This Useful Post:

    Bogertophis (09-12-2018)

  15. #19
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,009
    Thanks
    2,526
    Thanked 4,966 Times in 3,028 Posts

    Re: "Look but don't touch" animals?

    Interesting thread topic !

    My Corn snake and all my Royals are super laid back and docile
    and I'd trust them with anyone ...

    The Thai Red Bamboo rat and all my Kings are basically just fabulous display animals and I don't handle them through choice -just when cleaning vivs or moving them .


    Sent from my iPhone using Tapatalk




  16. #20
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,009
    Thanks
    2,526
    Thanked 4,966 Times in 3,028 Posts

    Re: "Look but don't touch" animals?

    Interesting thread topic !

    My Corn snake and all my Royals are super laid back and docile
    and I'd trust them with anyone ...

    The Thai Red Bamboo rat and all my Kings are basically just fabulous display animals and I don't handle them through choice -just when cleaning vivs or moving them .

    That said the I'm sure that if I had more time and fewer snakes I'd be able to spend time on the King snakes


    Sent from my iPhone using Tapatalk


    Sent from my iPhone using Tapatalk




  17. The Following User Says Thank You to Zincubus For This Useful Post:

    Bogertophis (09-16-2018)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1