» Site Navigation
0 members and 1,804 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,090
Threads: 249,228
Posts: 2,572,846
Top Poster: JLC (31,651)
|
-
Registered User
Share your dumerils boa experiences for newb
Hello!
It's been a long time since I posted on this website asking questions about my BP. About two years.
I love owning a BP and have had a great experience with him as my first snake. I'm thinking of getting something bigger though as my second and was researching good "step up" snakes that have similar care to BPs. It wouldn't be for a few years thought until I know I can take care of the new snake for the rest of its life without worrying about apartment pet requirements. I love dumerils and have been doing lots of research on their husbandry, temperament, etc. I definitely want something in the 5-7ft range as far as size goes but not quite burmese giant.
I'm just looking for people's experiences with their dumerils and what you think about them!
1.0 Normal ball python (Buddy)
0.1 Colombian boa (Tina)
-
-
I took in my sister's when she had to move to a place that would not allow snakes. It is very easy all in all. they like it a bit cooler so I just keep her at the ambient room temp (78-82) with no hot spot and she is fine. Eats great, sheds great, really mellow in temperament.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
I got a baby a few years ago and he's been a dream, always eats, sheds great, never hissed or struck at anyone. Slow growers which is nice. I like their pattern and the lower temps which fit in well with my short tails.
2.0 Python brongersmai
1.1 Python breitensteini
1.0 Python curtus
1.0.1 Python regius
1.0 Acrantophis dumerili
1.0 Boa constrictor
0.1 Heterodon nasiscus nasiscus
0.0.1 Pantherophis guttatus
-
The Following 2 Users Say Thank You to GoingPostal For This Useful Post:
Craiga 01453 (08-07-2018),kath_ (08-07-2018)
-
Registered User
Wow these sound like exactly what I'm looking for.
I've heard mixed reviews in their temperament (I've heard some can be extremely head shy and snappy) but for the most part they seem very mellow and docile.
I also hear they pee a lot lol. Would you recommend getting a baby or an adult for a first time boa owner?
1.0 Normal ball python (Buddy)
0.1 Colombian boa (Tina)
-
-
Re: Share your dumerils boa experiences for newb
 Originally Posted by kath_
Wow these sound like exactly what I'm looking for.
I've heard mixed reviews in their temperament (I've heard some can be extremely head shy and snappy) but for the most part they seem very mellow and docile.
I also hear they pee a lot lol. Would you recommend getting a baby or an adult for a first time boa owner?
If you have the choice, definitely start with a yearling or older. I got mine at 2 years old, and they're honestly still quite small at that size (2-3 feet), so it's a good spot!
Babies tend to be hard to get eating f/t, and they're also very small and shy. They're slow growers, so you'll have more than enough time to get used to the size if you get an older one... And then you'll wish they grew faster LOL.
Any snappy ones are very much a rarity. Like ball pythons, 99% of them should be docile.
Especially as they grow older, mine is increasingly less active and only wants to sit in a comfortable spot and stay there when I take her out to handle. She doesn't like moving! It's nice for guests to handle something big but very easy. They're also a burrowing species, and if you provide them with thick substrate, they will bury their entire bodies with only their nose poking out.
Mine is currently 5 years old and about 6 feet long.
Last edited by redshepherd; 08-07-2018 at 05:15 PM.
-
The Following 2 Users Say Thank You to redshepherd For This Useful Post:
MissterDog (08-27-2018),Team Slytherin (08-14-2018)
-
Registered User
My experience is very limited, I've had a rescue for about 3 1/2 weeks.
When I got her she was very stressed, and not eating, her previous owner had no heat source on her and kept her in a room with the lights on 24 hours a day, and he handled her constantly. She finally quit eating for him, so he gave her to me.
I got her temps up, I went with a uth and a thermostat to keep the bottom of her tank at 85, I went to lights with a night light on 12 hour temps to bring up the ambient temps, gave her Aspen bedding and two hides.
After one week of no handling with good temps and a 12 hour light cycle she started eating. One week later she started burrowing. Now she seems like a very happy snake, she has a great feed response, she strikes and constricts within seconds of seeing the prey.
It amazed me how fast she bounced back.
I'm starting to think that these are a real hidden gem in the reptile world. Care is pretty easy temperament is outstanding. Size seems about perfect for people that want a fairly large but manageable animal.
In many ways, I've discovered that it may be the perfect snake to keep.
-
-
I started with a baby, and have had him for almost a year. He's been an absolutely treat. By far, my favorite snake in my collection. He has refused a meal once - and became a shy eater for a while, but still absolutely wonderful.
I should also say, we have a 9ft. Female Dumeril's at the shop, so they can get VERY LARGE.
Last edited by PiperPython; 08-08-2018 at 10:29 AM.
Too Many...
That's what my wife says 
-
The Following User Says Thank You to PiperPython For This Useful Post:
-
I purchased a male dum who is about 1.5-2 years and I can echo all of the others comments 100%
I keep mine in reptile prime with 2 big hides and a big yet low piece of branchy wood which he enjoys. I keep a hot spot of 87-88 and the temp ranges from 77-85 cool to hot. He is a great snake who eats like a champ and is always out on display either half out a hide or slighly burrowed. He is very curious and when I am in the room hes right at the glass like "whats up?!?"
The guy I got was a hold back for a breeder and wasn't handled very much. He has never once hissed, struck, or anything of that nature, but he is at times "flighty" or "flinchy" I am working with him a few times a week to break him of that and it seems to be working. It only occurs initially or if he has been sitting out for a bit say on my bed or the couch and i got to touch him or move him he gives a flinch but thats it. My guy has great pink/orange colors on him and is a nice size and is and will grow much more. Great snake all around I am very happy I got him.
-
The Following User Says Thank You to Phillydubs For This Useful Post:
-
Registered User
Re: Share your dumerils boa experiences for newb
They are amazing! I got one about 7 months ago and I have no idea why they aren’t more popular! I regularly go to reptile shows and never see them, it was only by chance that I ran across one without knowing about them. I instantly fell in love with their temperaments. Every snake is different, but I think a lot of dumerils enjoy just sitting in your hand when you get them out. Mine hardly moves and is so calm. I had some trouble getting her to eat at first, but they are shy snakes so I reccomend getting a tank with at least 3 of its walls blacked out, I use construction paper. They are great shedders. I will say though, you probably will never see your snake, more likely you will just see a head poking out of the bedding which I personally think is adorable.
-
The Following User Says Thank You to Laura23 For This Useful Post:
-
Re: Share your dumerils boa experiences for newb
I love our Dumeril's! We've had Memphis for a few months now and she is amazing.
It sounds like you've been doing a lot of research, which is great. If you're wanting 5-7 feet you should probably stick with a male to be safe. 
Memphis is definitely active more frequently than the BP's, but she's still pretty chill. I don't know exactly how old she is, but I think she's a '17 hatchling. I've heard about it being difficult to get juveniles started on F/T but we lucked out. We use the hairdryer trick and she hasn't missed a meal so far.
Most Dum's are super docile. We'll start hook training soon just to cover our bases, but so far Memphis hasn't been snappy at all.
Let us know if you end up getting one! They're such underrated snakes.     
Sent from my Vivo X using Tapatalk
BALL PYTHONS: 1.0 Pied/Clark, 1.0 Pastel Vanilla Super Stripe/Sunny, 0.1 Dragon Fly/Buffy, 0.1 Pastel Vanilla Yellow Belly/Cher, 0.1 BEL (Mojave Lesser)/Arya, 0.0.1 Normal/Norm, 0.1 Cinnamon Enchi/Peaches, 1.0 Cinnamon Calico/Yoshi, 0.1 Pewter Het Dreamsicle/Ariel
BOAS: 0.1 Dumeril's/Memphis, 0.1 BCL/Artemis, 1.0 BCO/Grimm, 0.1 Suriname BCC/Rhubarb
CORN SNAKES: 0.0.1/Mushu
MORELIA: 0.1 Bredli/Zelda, 0.1 Granite IJ/Bridget, 0.1 Caramel Diamond Jungle/Pixie
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|