Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 756

0 members and 756 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,101
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 34
  1. #11
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    951
    Thanks
    343
    Thanked 948 Times in 460 Posts
    Images: 16

    Re: I'm conflicted...

    My husband was actually TERRIFIED of snakes....all sizes, didn’t matter. It took him almost two years to finally let me get Ramsey and then shortly after Anubis (Boa) so here we are almost at two years later and just a few months ago he felt comfortable finally holding my biggest (Ramsey) now he is willing to hold Anubis at anytime (She was the first snakes he ever held at a whopping 175 grams) she’s now almost 500g and over 3ft. He knows how large she’s going to get but through the time and consistently handling her as she grows, it’s become easier as an adaptation to the realization of how big she’s going to get. It truly depends of the individual and their comfort level and confidence and willingness to adapt/acceptance imo.


    Sent from my iPhone using Tapatalk

  2. The Following User Says Thank You to Aerries For This Useful Post:

    Craiga 01453 (07-02-2018)

  3. #12
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: I'm conflicted...

    Quote Originally Posted by Skyrivers View Post
    Instead of adding right now, why not work on increasing her experience with larger pythons. Babies to adults. Let her warm up to the idea. Just a suggestion. Great you two are doing well.
    I've considered that, but I'm thinking I can add soon while educating her moving forward. I'm "itching" for something new, but not "jonesing" yet, so I doubt anything will be happening real soon anyhow.
    Thanks!!

  4. #13
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: I'm conflicted...

    Quote Originally Posted by Aerries View Post
    My husband was actually TERRIFIED of snakes....all sizes, didn’t matter. It took him almost two years to finally let me get Ramsey and then shortly after Anubis (Boa) so here we are almost at two years later and just a few months ago he felt comfortable finally holding my biggest (Ramsey) now he is willing to hold Anubis at anytime (She was the first snakes he ever held at a whopping 175 grams) she’s now almost 500g and over 3ft. He knows how large she’s going to get but through the time and consistently handling her as she grows, it’s become easier as an adaptation to the realization of how big she’s going to get. It truly depends of the individual and their comfort level and confidence and willingness to adapt/acceptance imo.


    Sent from my iPhone using Tapatalk
    Thanks, man. When/if the time comes I'll definitely be starting with a juvenile so she can develop a trust while the snake grows. She's certainly showed willingness to adapt and accept, I just don't want to push too far. She's come a long way, and I'm happy she's put the majority of her fears behind her as well as grateful she's been willing to step outside her comfort zone to support me and my passion.
    I'm glad your hubby has come around too! It's always more fun when you can enjoy things together!!

  5. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    Aerries (07-02-2018)

  6. #14
    BPnet Royalty Gio's Avatar
    Join Date
    05-28-2012
    Location
    Minneapolis
    Posts
    4,800
    Thanks
    6,994
    Thanked 6,781 Times in 3,056 Posts
    It's been mentioned,

    I'll say it again if the carpet scene isn't good for you at the moment. Try an island boa constrictor.

    You'll get a nice handling snake, something that is semi arboreal, hardy, typically always ready for food, and a smaller size. You are maybe looking at 5.5 feet for a male depending on the species/subspecies.

    Boas move nice and slow usually and seem to tolerate handling well, so well for some that you'd swear they enjoy it.

    These boas will have far less girth than the STP and will be equal or a little less in length.

    Another option,,,, Green Tree Python. Probably not a handling dream, but smaller than the carpets and excellent for display purposes.

    My wife isn't at all into the hobby, but she does glance at the cages now and then and likes the way the room is set up.

    It's hard to say as I don't have a feel for the vibe you two have. If you get a baby snake, they all start off small, and boas should be grown slowly so you won't be looking at anything big 2 years form now.

    Personally,,, and this is just my opinion; If you can't get the snake you think you'll really dig, don't get one with the same behaviors of the ones you own now just to have another. Wait it out and get the one you want.

    Boa constrictor heads look similar to STP heads so maybe you have a chance LOL!

  7. The Following 2 Users Say Thank You to Gio For This Useful Post:

    Craiga 01453 (07-02-2018),richardhind1972 (07-02-2018)

  8. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If it is just about the head/body discontinuity that upsets her then might I suggest thinking outside the box and looking at something like a woma python or a blackhead python? They are basically built like oversized king snakes.

    Or, if you are okay with something smaller, you have the option of rosy boas or sand boas or anything in the Antaresia genus
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #16
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,567
    Thanks
    2,968
    Thanked 9,997 Times in 4,836 Posts
    Images: 34
    I would also look at sand boas and Savu pythons. Both are thin-bodied snakes that stay fairly small, and they are easy to keep.

  10. The Following User Says Thank You to bcr229 For This Useful Post:

    Gio (07-02-2018)

  11. #17
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: I'm conflicted...

    Quote Originally Posted by asplundii View Post
    If it is just about the head/body discontinuity that upsets her then might I suggest thinking outside the box and looking at something like a woma python or a blackhead python? They are basically built like oversized king snakes.

    Or, if you are okay with something smaller, you have the option of rosy boas or sand boas or anything in the Antaresia genus
    Thanks for the reply. Womas and blackheads aren't my personal flavor, nor are rosy or sand boas. I appreciate the time and thought though. Thank you

  12. #18
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77
    Craig, just keep your lady happy. I drive mine nuts and I am shown a lot of patience. I have a snake habit, guitar habit, motorcycle habit, sword habit.. I have issues. Did you know guitars can actually reproduce on their own? At any rate, I know when I have pushed it too far. If I get one more guitar I'm going to end up living under a bridge somewhere. I used to raise tarantulas as well, but I gave that up because I was the only one that got any enjoyment out of them.
    Honest, I only need one more ...

  13. #19
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: I'm conflicted...

    Quote Originally Posted by bcr229 View Post
    I would also look at sand boas and Savu pythons. Both are thin-bodied snakes that stay fairly small, and they are easy to keep.
    Thanks! Sand boas aren't for me, but I hadn't considered a Savu. I've only heard of them mentioned a few times in passing, so know next to nothing about them.
    Now I have something new to learn about
    Thanks!

  14. #20
    BPnet Royalty dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,931
    Thanks
    8,330
    Thanked 10,043 Times in 3,987 Posts
    Images: 134

    Re: I'm conflicted...

    First, as you've said before; Keep your lady happy and be respectful! I know I don't need to tell you that twice.

    Secondly, if she doesn't like Boas, that's fine, it's her prerogative. However, keep in mind both Male BCI's and Dwarf species, do stay much smaller than Female BCI's or BCC's.

    They also tend to be very predictable and move deliberately and fairly slowly. They can have a wicked strong feeding response, but otherwise, are really docile. They also start out pretty small and you and she can grow with he/she.

    Katie loves Behira now (she loves her personality and inquisitive nature), and isn't too worried about when she's 6-7FT and 15 pounds or so! She's spent the better part of year learning her and watching her grow and knows her now. It would have been another story if I brought home a 7FT female!

    Anyway, just my two cents. I love Boa's, but also think #1 is the most important thing. Do the right thing by your girl.

    Good luck brother and keep us in the loop.

  15. The Following User Says Thank You to dakski For This Useful Post:

    Craiga 01453 (07-02-2018)

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1