Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 736

2 members and 734 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,201
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 1 of 2 12 LastLast
Results 1 to 10 of 15
  1. #1
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Champagne x Ghost x Spider

    I cannot find pictures of this anywhere.

    Checked morph market.
    Checked world of bp morph list.
    Google searched.

    Has this been done?

    I've been gone awhile so not sure if there are other resources I am missing.

    I am debating on getting a mimosa for my honeybee...

  2. #2
    BPnet Veteran Slicercrush's Avatar
    Join Date
    02-12-2018
    Location
    Columbus, GA
    Posts
    408
    Thanks
    135
    Thanked 265 Times in 180 Posts
    Champagne x Spider is lethal, I believe
    *****

    The more silent you become, the more you are able to hear...

    ​1.0 Super Cinny Banana Het Ghost BP - "Churro"
    1.0 Mack Snow Leopard Gecko
    0.1 Normal Leopard Gecko

  3. The Following User Says Thank You to Slicercrush For This Useful Post:

    Turbo Serpent (06-05-2018)

  4. #3
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,570
    Thanks
    2,971
    Thanked 10,004 Times in 4,839 Posts
    Images: 34

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by Slicercrush View Post
    Champagne x Spider is lethal, I believe
    You are correct.

  5. The Following 2 Users Say Thank You to bcr229 For This Useful Post:

    Slicercrush (06-05-2018),Turbo Serpent (06-05-2018)

  6. #4
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1
    Very sad to hear. That would explain why I haven't seen it... back to the drawing board I guess.

    The spider gene needs to be mapped out so we can see what all is going on. I still feel as though it is a co-dom and the super is lethal.
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  7. #5
    BPnet Veteran Slicercrush's Avatar
    Join Date
    02-12-2018
    Location
    Columbus, GA
    Posts
    408
    Thanks
    135
    Thanked 265 Times in 180 Posts

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by Turbo Serpent View Post
    Very sad to hear. That would explain why I haven't seen it... back to the drawing board I guess.

    The spider gene needs to be mapped out so we can see what all is going on. I still feel as though it is a co-dom and the super is lethal.
    If you're looking for a good reference for lethal combos/gene issues, this is a good one: http://www.owalreptiles.com/issues.php
    *****

    The more silent you become, the more you are able to hear...

    ​1.0 Super Cinny Banana Het Ghost BP - "Churro"
    1.0 Mack Snow Leopard Gecko
    0.1 Normal Leopard Gecko

  8. The Following User Says Thank You to Slicercrush For This Useful Post:

    Turbo Serpent (06-05-2018)

  9. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by Turbo Serpent View Post
    I still feel as though it is a co-dom and the super is lethal.
    There are a number of us who have been saying this for years... And for years we have been roundly ignored/lambasted.

    OWAL did a decent write up summarizing the thoughts of us a couple years ago: http://www.owalreptiles.com/superspider.php
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #7
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by asplundii View Post
    There are a number of us who have been saying this for years... And for years we have been roundly ignored/lambasted.

    OWAL did a decent write up summarizing the thoughts of us a couple years ago: http://www.owalreptiles.com/superspider.php
    I just read that yesterday. Pretty good points, but like you said people have been saying it for years. Its sad that this gene affects the neurological side of the animal, because it is a beautiful display and the super, from the few I have seen that died in egg, were all pretty and silver too.
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  11. #8
    BPnet Veteran Trisnake's Avatar
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    551
    Thanks
    378
    Thanked 290 Times in 209 Posts
    Images: 1

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by Turbo Serpent View Post
    Very sad to hear. That would explain why I haven't seen it... back to the drawing board I guess.

    The spider gene needs to be mapped out so we can see what all is going on. I still feel as though it is a co-dom and the super is lethal.
    I feel the same.

    Wouldn’t spider HAVE to be a co-dominant trait? Since it was proven allelic to blackhead? Would that be possible if the spider gene is dominant?

    edit: the jaguar gene in carpet pythons is considered to be analogous to the spider gene in ball pythons, if I’m not mistaken, with the super being a leucistic all white snake. Very similar to the supposed stillborn super spiders. This is also a lethal gene combo in carpets.
    Last edited by Trisnake; 06-10-2018 at 12:29 AM.

  12. The Following User Says Thank You to Trisnake For This Useful Post:

    Turbo Serpent (06-11-2018)

  13. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by Trisnake View Post
    edit: the jaguar gene in carpet pythons is considered to be analogous to the spider gene in ball pythons, if I’m not mistaken, with the super being a leucistic all white snake. Very similar to the supposed stillborn super spiders. This is also a lethal gene combo in carpets.
    Nick Mutton wrote up a nice piece for HerpNation (back in 2016, when it was still functional) saying exactly this. It has been cloned here, minus pics: http://www.iherp.com/Public/Blog/Detail.aspx?uid=177785
    Last edited by asplundii; 06-11-2018 at 10:23 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. #10
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Champagne x Ghost x Spider

    Quote Originally Posted by Trisnake View Post
    I feel the same.

    Wouldn’t spider HAVE to be a co-dominant trait? Since it was proven allelic to blackhead? Would that be possible if the spider gene is dominant?

    edit: the jaguar gene in carpet pythons is considered to be analogous to the spider gene in ball pythons, if I’m not mistaken, with the super being a leucistic all white snake. Very similar to the supposed stillborn super spiders. This is also a lethal gene combo in carpets.
    The way we refer to co-dom, dom and such is just how the single mutant gene looks in heterozygous and homozygous forms. Other genes have no baring on it. It being allelic proves that there is zero reason for the super spider not to exist, as the locus doesn't have any issues.
    If you can make super blackheads, you can make super spiders, and ignoring all other evidence, we can still ask what's the logical conclusion based of this alone. It's lethal.

  15. The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:

    asplundii (06-12-2018),Slicercrush (06-12-2018)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1