Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,198

1 members and 2,197 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,094
Threads: 249,235
Posts: 2,572,893
Top Poster: JLC (31,651)
Welcome to our newest member, PhillipLindgren
Results 1 to 8 of 8
  1. #1
    Registered User
    Join Date
    03-02-2018
    Posts
    178
    Thanks
    2
    Thanked 180 Times in 68 Posts

    Quick question about eggs...

    Not sure if this will be a dumb question or not but here goes....

    If a female snake is never with a male, will they still lay eggs?

    Our bearded dragon was never with a male her whole life and she never laid eggs so there was never an issue with egg bound or anything. I heard some dragons do lay eggs even without a male around.

    Just wondering if Balls are the same? Wondering if this is something we are going to have to watch for in Mia as she gets older. (who by the way is ready to jump up a size in food !)

    Thanks.

  2. #2
    Registered User Anne Frankenstein's Avatar
    Join Date
    05-20-2018
    Location
    GTA, Ontario
    Posts
    6
    Thanks
    7
    Thanked 4 Times in 2 Posts
    A female snake can't lay eggs without having sex, you'll be fine. Only fish and frogs are capable of hermaphroditism.

  3. #3
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    there are cases of parthenogenesis in BP's but it is rare.

    Edit: other times, someone will buy/adopt or take up care of a (mature) female who was previously paired w/ a male but never became gravid or laid eggs. she retained sperm, which they can do for quite a long time, only to lay a surprise clutch for her new owner!
    Last edited by Ax01; 05-24-2018 at 12:23 PM.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  4. The Following User Says Thank You to Ax01 For This Useful Post:

    Bogertophis (05-24-2018)

  5. #4
    Registered User
    Join Date
    07-15-2017
    Location
    West Virginia
    Posts
    48
    Thanks
    6
    Thanked 39 Times in 19 Posts

    Re: Quick question about eggs...

    Quote Originally Posted by Anne Frankenstein View Post
    A female snake can't lay eggs without having sex, you'll be fine. Only fish and frogs are capable of hermaphroditism.
    I have to just mention here - that some reptiles will lay non-viable eggs without ever being with a male. My iguana did and we got her as a hatchling and she was never with another iguana at all.


    Sent from my iPhone using Tapatalk

  6. The Following User Says Thank You to Rvnhawk For This Useful Post:

    Bogertophis (05-24-2018)

  7. #5
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,987
    Thanks
    29,679
    Thanked 20,783 Times in 12,440 Posts

    Re: Quick question about eggs...

    Quote Originally Posted by Anne Frankenstein View Post
    A female snake can't lay eggs without having sex, ....
    NOT TRUE! Sorry!...I have 2 large adult Florida rat snakes (yellow x gulf hammock?) that have NEVER bred (I've had them since they were young) &
    every year since they've been big enough, they each lay 2 clutches of eggs, the first clutch is by far the bigger of the 2. Each of them produces more
    than TWO DOZEN lovely but infertile eggs every year, which is why no matter how much I feed them (a LOT!) they are about half the size of the males.
    Yes, I have 2 males, but unless they can fertilize females in another room thru the air...??? -they have never met. The males are each hefty 7' snakes.
    The females are only about 5'. None of them ever turn down food...lol. They're good pets, docile & good with public "meet & greets".

    Also, many years ago I lost a young desert Cal. king to egg-binding. I had her since a hatchling, she was never bred either, & vet couldn't save her.

    FYI- the rosy boa that I took in from a nature museum reproduced by parthenogenesis: she had been there for about 15 years, housed with 2 other
    females (for sure!) and was in very poor condition when they gave her to me. She was very stressed (they housed all 3 snakes in a single cage that
    was far too small for them & not a good idea anyway) & she had been refusing nearly all food for the last 2 years, because the cage was also poorly
    heated with only an over-head light, so between her age & lack of food, she had very poor muscle tone when I agreed to take her off their hands.

    She did nothing but EAT for me, & digested well: about 40 small rodents (fuzzies & hoppers) that first month, then went off eating but gained weight.
    I recognized the signs...later that summer she expelled a bunch of slugs and one barely-alive baby boa. I thought it must be dead at first...it was so
    weak & tiny, with only one eye, a bent-neck & a few spinal bumps. Also a very slow umbilical closure. Each day I came home from work, expecting
    to see a dead snake, but each day she looked back at me and drank water from my finger. So I called her Long Shot. She actually ate pinkies with
    enthusiasm from my tongs, and shed a number of times, surprisingly without my help. I was totally pulling for her, but one day when she was 8 mos.
    old, I found she had suddenly passed away. Most likely from some internal abnormality. She really tried to survive, but that was not her lot in life.

    That is how & why I got into breeding rosy boas back then. The adult female rosy was eating like crazy for me & I could just imagine her making some
    more neonates the next year that would suffer & not survive, and because she still had poor muscle tone, she had great difficulty pushing out slugs,
    whereas live babies pretty much do the work of leaving. I am fussy about never breeding snakes that are too young, & breeding an OLD snake was
    just as bad...but I had no good options. I got her a mate, and for the next 6* years she had LOTS of big healthy offspring. *One year, in the middle
    of those, I didn't allow her to mate and she nearly died trying to expel all the slugs. So the next year I gave in...& after 5 total years of her breeding,
    she finally quit on her own. She was an awesome snake, she lived 11 years with me before passing of old age (about 26+). She had nearly 50 'kids'.

    So don't under-estimate the reproductive inclination of your snakes...

    And Maybeka, that was not a 'dumb question'! The short answer is "maybe".
    Last edited by Bogertophis; 05-24-2018 at 01:05 PM.

  8. #6
    BPnet Senior Member AbsoluteApril's Avatar
    Join Date
    03-05-2014
    Location
    Utah
    Posts
    2,080
    Thanks
    2,325
    Thanked 2,605 Times in 1,296 Posts

    Re: Quick question about eggs...

    My 17 yr old corn snake has laid a clutch of eggs the last two years. I've raised her from a hatchling and she has never come in contact with another corn snake. She started laying after I adopted a male corn, again, they were never in contact, just both are kept in my snake room. They were infertile eggs not partho (where the mother self-fertilizes).
    Our leachie gecko has also been laying infertile eggs each year for the past 4 years (she's the only gecko we own and kept in the bedroom).

    So while it can happen, it is not a common occurance.
    Last edited by AbsoluteApril; 05-24-2018 at 01:08 PM. Reason: fixing wording
    ****
    For the Horde!

  9. #7
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,987
    Thanks
    29,679
    Thanked 20,783 Times in 12,440 Posts
    In parthenogenesis, the offspring is a genetic clone of the mother, so with only one set of genes, defects can easily occur as they did with "Long Shot".

    If it were otherwise (if the offspring were likely to be healthy) I wouldn't have minded so much, but as it was, I had a tough choice to make. In nature,
    this happens as a survival mechanism when there is a lack of mates, so apparently some do turn out OK. Parthenogenesis has been known to occur in
    other live-bearing snakes (garter snakes & rattlesnakes), but years back when my rosy pulled that stunt, no one had written up any others that I could
    find.

    Keeping snakes is like a box o' chocolates...you never know what you're gonna git.

    When my snakes lay infertile eggs, I always save (& candle) the ones that look good. When I do a program, people love to see & handle snake eggs, &
    many of my rat snake eggs don't go bad, so they're great for "show & tell". Props are one more way to help ppl understand & appreciate snakes.

  10. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    For anyone interested in some of the actual science behind parthenogenesis in snakes I highly recommend checking out Dr. Warren Booth's publications:

    https://www.booth-lab.org/publications
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (05-25-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1