» Site Navigation
1 members and 757 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,908
Threads: 249,107
Posts: 2,572,126
Top Poster: JLC (31,651)
|
-
Registered User
What substrate do you use for your O. Porphyraceus Coxi?
I've had my little coxi, Secundus Draconus Decorus, for about a month now and he just loooooooves to burrow. I'm using Eco Earth as a substrate right now but was curious if there was something that would be better for him to dig around in.
-
-
very nice Coxi! post more pix!
i also use Eco Earth. mine likes to burrow about half the time. he will burrow and then hide right underneath his waterbowl. he did this also at the store where they used Cypress Mulch.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Registered User
-
The Following 5 Users Say Thank You to craspy For This Useful Post:
Avsha531 (05-23-2018),Ax01 (05-23-2018),Craiga 01453 (05-24-2018),ladywhipple02 (05-23-2018),Prognathodon (05-23-2018)
-
Re: What substrate do you use for your O. Porphyraceus Coxi?
WOW that animal is gorgeous! Just switched my BRB to Reptile Prime last week, aside from whatever controversy surrounds it the product itself is wonderful at maintaining humidity and she loves burrowing in it. Would highly recommend it, especially where high humidity is needed
1.0 Kenyan Sand Boa - Sir Hiss🎩🐍
0.1 Pastel Ball Python - Exzahrah
0.1 Brazilian Rainbow Boa - Nymeria
0.1 Suriname Red Tail BCC- Sascha
0.1 WT Ball Python- Ariana
1.0 Bumblebee Ball Python- Fabio
WISHLIST:
Dumerils Boa
Candino BP
Granite IJ Carpet Python
White Lipped Python
Komodo Dragon
"Normal is just a setting on the washing machine..."
-
-
Re: What substrate do you use for your O. Porphyraceus Coxi?
 Originally Posted by craspy
He just came out of shed, so I can take some nice pictures.

haha i love your lil substrate eater errr... i mean burrower.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Easiest substrate for burrowing animals are coco coir type substrate (regardless of the brand) or aspen knowing aspen tend to mold quickly.
-
-
Re: What substrate do you use for your O. Porphyraceus Coxi?
 Originally Posted by Deborah
Easiest substrate for burrowing animals are coco coir type substrate (regardless of the brand)
I have a few species that are prone to burrowing and I will concur with the coir-type substrate with a small caveat; if you can find some, then for every 5 parts coir I suggest adding one part high quality sphagnum (NZ or Orchid I find are best) and one to two parts oak leaf litter (you could use magnolia as well but you will need to break them up as they are much larger than oak leaves). I have found that using this mix helps keep the coir from compacting, helps the coir maintain a bit more stable hydration level (e.g., not drying out to a brick and then turning into a soggy mess), and creates an easier burrowing substrate for the animals because there are little air gaps and roughage for traction/leverage. I also think it looks a bit nicer/more natural that just straight coir.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Prognathodon (05-24-2018)
-
Aspen is good for burrowing but i would not use it for a Coxi. it dries out very quickly and will not be able to hold the proper humidity unless u live in a naturally high humid climate.
Edit:
 Originally Posted by asplundii
I have a few species that are prone to burrowing and I will concur with the coir-type substrate with a small caveat; if you can find some, then for every 5 parts coir I suggest adding one part high quality sphagnum (NZ or Orchid I find are best) and one to two parts oak leaf litter (you could use magnolia as well but you will need to break them up as they are much larger than oak leaves). I have found that using this mix helps keep the coir from compacting, helps the coir maintain a bit more stable hydration level (e.g., not drying out to a brick and then turning into a soggy mess), and creates an easier burrowing substrate for the animals because there are little air gaps and roughage for traction/leverage. I also think it looks a bit nicer/more natural that just straight coir.
is oak leaf litter full leaves or is it chopped/shredded or mulched?
Last edited by Ax01; 05-24-2018 at 02:22 PM.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Re: What substrate do you use for your O. Porphyraceus Coxi?
 Originally Posted by Ax01
is oak leaf litter full leaves or is it chopped/shredded or mulched?
Full leaves. Some of them may be broken a bit from collection/packing/shipping and such
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|