» Site Navigation
0 members and 1,856 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,241
Posts: 2,572,926
Top Poster: JLC (31,651)
|
-
Registered User
Carpet Python Non-Rodent Diet
Would love to get your opinions on my Coastal/Jungle Carpet Python's diet.
It's a long story but she refuses to eat rats, don't want to bore you guys.
But at the moment she gets a 200g to 250g Quail every 14 days or so, I'd say about the equivalent of a Medium Sized Rat in terms of weight, maybe a large?
She is a Female Adult 3.5 Years Old. She's been on this feeding for about a year, and to me, she looks very healthy, good length, good weight.
She'll eat anything other than rats lol, Hamsters, Rabbit, Mice... The reason I went with the Quail diet was that I heard many good reviews on a bird diet for your snake and I didn't think the other options were appropriate in terms of enough nutrition, other than rabbit but a bit too pricey to have all the time.
As Carpet Owners do you feed your adults a medium-sized rat or large? Would love to get your opinions if you think I should be fine with the way I'm going or maybe you completely disagree and I should go back to trying rats or maybe I should be using a different type of bird instead?
Or perhaps there are owners out there in a similar situation and their Snake(s) only eat a particular Non-Rodent diet, would love to hear your experiences.
It's nice to have a place to go and discuss snakes lol, can't have these conversations with friends and family.
~We Don't Have To Agree On Anything To Be Kind To One Another~
-
-
I had a mangrove snake that would only eat birds, and the angry monster lived 12 years with no apparent health issues. He came to me fully grown, so I have no idea how old he may have been, being wild caught and all. Only thing I found was that snakes seem to digest birds faster, so I needed to feed more often than if I were feeding rodent prey. Poops were pretty loose as well, but over all they seemed to be nutritionally sound.
-
-
Re: Carpet Python Non-Rodent Diet
I’ll begin where you ended. I can’t have these conversations with personal friends or family either as none of them have snakes or would want to. Oh well...
As for my Morelia Bredli, he is 2.5 years old, roughly 4-5 feet long. I’m not sure of his exact weight at the moment and I’ve only feed him rats to this point. Sometimes large but most often medium sized rats. From 1.5 years old until 2 it was a medium rat every 7 days but for the past 6 months I’ve varied the length of time between feedings and it’s always more than 7 days. It seems to be working. He only refused once when he was in shed. I will probably mix in large rats more often now as he has put on size.
I’ve thought of varying his diet as well but I’ve been afraid he might choose to not eat rats. Btw, I still feed live so I don’t know if that helps or not.
0.1 Super Pastel BP "Melly"
1.0 Banana/Coral Glow BP "Titan"
1.0 Morelia Bredli "Alpha Omega"
0.1 Cavachon "Lola"
0.1 Tabby Cat “Gato”
0.2 Chickens
1.0 Thoroughbred “Beau”
1.0 Siberian Hamster "Bean"
0.1 Wife
1.2 Kids
Full House  Living the suburban farm life in Miami.
-
The Following User Says Thank You to rock For This Useful Post:
-
Re: Carpet Python Non-Rodent Diet
I believe most animals will eat anything if they're hungry enough but the most important thing is that your snake is healthy. I feed my adult carpets mostly medium to jumbo rats but they'll get chicks and mice as snacks sometimes. I'd like to try them with rabbits soon too. I'm a big fan of a varied diet for all my snakes. I feed my critters every 14 days on average.
Last edited by EL-Ziggy; 05-22-2018 at 12:10 AM.
3.0 Carpet Pythons, 1.0 Olive Python
1.0 Scrub Python, 1.1 BI
-
The Following 2 Users Say Thank You to EL-Ziggy For This Useful Post:
Craiga 01453 (05-22-2018),RickyNY (05-22-2018)
-
Registered User
Re: Carpet Python Non-Rodent Diet
 Originally Posted by Alter-Echo
I had a mangrove snake that would only eat birds, and the angry monster lived 12 years with no apparent health issues. He came to me fully grown, so I have no idea how old he may have been, being wild caught and all. Only thing I found was that snakes seem to digest birds faster, so I needed to feed more often than if I were feeding rodent prey. Poops were pretty loose as well, but over all they seemed to be nutritionally sound.
Loool haven't we all had at least one Angry Monster we just didn't know what to do with, had a Blood Python I kept saying I was going to drop off at my Mother-in-Laws backyard. I always told myself that it seemed she would digest the Bird a lot easier, even though it would leave a big bulge in her, she just seemed more comfortable the next 48 hours. I personally never found a difference in her poop.
It's good to know EL-Ziggy and Rock you guys are doing Large Rats and even Jumbo, something to consider. If I ever did 2 Quail at a time I think I would push it to 21 days. I feel like sometimes we as owners feed our snakes a bit more, and without the freedom to roam as much as they can in the wild to burn it off. I remember talking to 2 Veterans at a reptile show and they said back in their days they were feeding their adult snakes Once a month, that "Us new guys spoil our snakes nowadays"
Definitely got me thinking.
~We Don't Have To Agree On Anything To Be Kind To One Another~
-
-
Re: Carpet Python Non-Rodent Diet
 Originally Posted by EL-Ziggy
... I'm a big fan of a varied diet for all my snakes. I feed my critters every 14 days on average.
I think that's healthier, more natural, when they'll accept some variation. Not all snakes will, but maybe that's because they don't get as hungry as they
do in the wild. Speaking for myself, I'd never touch canned Dinty Moore Beef Stew at home, but it sure is good when I'm camping out... Same thing?
-
-
Re: Carpet Python Non-Rodent Diet
My carpets get fed every two weeks (once per week when they were youngsters). My big Bredli Yingarna gets mostly medium rats, occasionally large, with a rabbit kit/juvenile about once a month. Same schedule for Yurlunggur/Bruce, my JCP, except he doesn’t get the large rats. Moresby, my younger IJCP gets weaned rats or pups.
Bruce and Ying have also gotten chicks occasionally. I offered Moresby a rabbit kit last week and he wanted nothing to do with it. I haven’t tried him on any type of bird yet.
Sent from my iPad using Tapatalk Pro
0.4 BPs, 0.1 Antaresia, 2.1 Morelia, 0.0.1 Liasis, 1.0 Aspidites, 0.1 Blood, 1.1 Kings, 2.0 Milks, 1.2 Corns, 2.0 Ratsnakes, 0.1 Hognose, 1.0 RTB, 2.1 KSBs, 1.0 Tortoise, 1.0 Skink, 3.0 dogs, 2.1 Human serfs
-
The Following User Says Thank You to Prognathodon For This Useful Post:
-
If your animal is eating and healthy then I do not see the need to try and force it to eat something it does not want to eat. Remember, rats are not the normal diet for most all the snakes we keep, this is especially true when it comes to carpet pythons, they are just a convenient feeder for us to feed them in captivity. In the past they were pretty much the only option but now we have more choices and I say make full use of that freedom; Qu'ils mangent de la caille
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|