Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,914

2 members and 1,912 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,229
Posts: 2,572,847
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Results 1 to 6 of 6

Thread: Nidovirus

  1. #1
    Registered User
    Join Date
    05-08-2018
    Posts
    3
    Thanks
    1
    Thanked 0 Times in 0 Posts

    Nidovirus

    Hello everyone, so I have a dilemma. Last year I bought two ball python from BHB and they ended up being Nidovirus positive. Currently they have been dead for a few months, the first one dying in January and the other being put down in March, and one other that I adopted that was also put down. I took care of a friends snake (who is now my snake and was purchased at the Arlington show in Feb. ) every weekend until March 23rd when, even though there was minimal contact, I decided to cease all contact completely (even though I was using lysol and disinfecting wipes). Me and my vet still had no proof that it was Nido until I received positive results in March. I left the friends snake with them for awhile until I disinfected everything and it had been about a month since my last snake who was sick was put down. I tested the new girl before I brought her in my home and the results came back negative, however, I don't know how long Nidovirus takes to show up on tests. So my dilemma is, it's been about a month since her test came back negative, but I was wondering if anyone knew how long it took a RNA virus to show up on a PCR test. Also, the last animals I had that were "exposed" were crested geckos and a cornsnake (who I tested and it came back negative and he's still doing great, but in his own room now) but I would also like to ease the thought that my Crested gecko could have it, even though he's perfectly healthy in my book. Thanks you!

  2. #2
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts
    Not too sure myself but here is something you can read that might help a little. There are links at the bottom to recent stuff about it in snakes.
    http://www.stengleinlab.org/blog/201...virus_FAQ.html
    Last edited by Sauzo; 05-10-2018 at 09:03 AM.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  3. The Following User Says Thank You to Sauzo For This Useful Post:

    Bogertophis (05-10-2018)

  4. #3
    BPnet Lifer Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    2,030
    Thanks
    952
    Thanked 4,329 Times in 1,628 Posts
    Images: 120

    Re: Nidovirus

    Quote Originally Posted by Bellabu99 View Post
    I don't know how long Nidovirus takes to show up on tests.
    Nidovirales is a classification of virus. As there are an enormous amount of Nidovirus types and mutant strains-it would be difficult to guess the replication rate of a standard type in a cold blooded organism...Regardless I would imagine it would show up on a PCR test within a few months as genetic tests are highly accurate and it only takes a minute amount of RNA/DNA to amplify.

    Nidovirales are often enveloped (i.e. shielded) in a protein capsule. Sterilization of equipment (not disinfection) is required for complete destruction. Some of these viruses can last years and even decades outside of their hosts in the proper environments. Due to their durability these viruses are quite common as opportunistic infections.
    *.* TNTC

  5. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Bogertophis (05-10-2018)

  6. #4
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,604
    Thanks
    3,027
    Thanked 10,071 Times in 4,868 Posts
    Images: 34
    I don't know if it applies to Nido in particular but Univ of FL has recommended testing for viruses 90 days apart if it's done as part of your normal QT process to see if there are changes in titers and to help rule out both false positives and false negatives.

  7. The Following User Says Thank You to bcr229 For This Useful Post:

    Bogertophis (05-10-2018)

  8. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    First, I would advocate listening to the GTPKeeper podcast and MPR podcast episodes that were exclusively devoted to this topic. That should help you get a better grip on what you are dealing with.

    Next, here is a fairly comprehensive article on nido: https://www.sciencedirect.com/scienc...42682217304130

    Less relevant but still interesting is this one on nido in shinglebacks: http://journals.plos.org/plosone/art...l.pone.0165209


    There is a lot of generalized speculation in this thread that is being thrown out as if it were fact and I would caution against that. Nido are a branch of a class of viruses that includes many known pathogens but that does not mean that any one type of nidovirus will absolutely prove infectious or pathogenic across a wide range of species. In fact, is seems from some of the limited data available that there might be strain/host specificity and also that some species may be inherently resistant while others are dramatically susceptible. However, more data on both of those is necessary before we begin hanging our hats on those ideas. As a whole, this broad class of viruses are somewhat robust but they are not the near immortal entities that has been implied. Typically, under ideal conditions this type of virus can survive 4-10 days in the environment. Increased heat, decreased humidity, and the active use of disinfectants and detergents greatly reduces the survival of viral particles.

    As far as how long you should wait before you can assume your animal is indeed clean... Someone above mentioned a retest at 90 days after the first test and I would be inclined to agree. Not because that is the know incubation time but because that is just generally good quarantine time. Personally, I would also advocate a repeat test after one year just for good measure since there does seem to be some evidence for latent carrier state in some animals.
    Last edited by asplundii; 05-10-2018 at 02:50 PM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 5 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (05-10-2018),Bellabu99 (05-25-2018),Bogertophis (05-10-2018),dr del (05-10-2018),Team Slytherin (05-25-2018)

  10. #6
    Registered User
    Join Date
    05-08-2018
    Posts
    3
    Thanks
    1
    Thanked 0 Times in 0 Posts

    Re: Nidovirus

    Hey everyone, thank you for the help, I have read almost everything there is about Nidovirus while dealing with it. I know that nidovirus is recommended to be tested before 4 days outside of the host because on the 4th day it begins dying. Everyone still seems fine, the snake that I was worried about has shed again and I plan on testing her again on tuesday. I had a phone call with the lab director of RAL, and he said based on the evidence so far gathered, he believes my crested geckos to be safe, but I think I will send a sample off of the one exposed/kept here the longest to him for testing. I have two new snakes in a quarantine room and everytime that room is entered, lysol is sprayed and gloves/disinfecting wipes are used to kill everything that might have had relation to the snake in question. however, the snake in question still seems fine after about 2 months of ceased contact, and over a month since I tested her. Fred, the gecko in question seems absolutely fine, I check his mouth occasionally and I haven't seen anything out of the ordinary. I will keep everyone posted on how everything progresses. Currently, Crested gecko and cornsnake in question are still absolutely fine, and so is the ball python in question as well. Thank you all, if anyone finds out more or has friends who know more, please direct them here.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1