Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 981

0 members and 981 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,142
Posts: 2,572,345
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 9 of 9
  1. #1
    Registered User Lost571's Avatar
    Join Date
    10-24-2017
    Posts
    81
    Thanks
    5
    Thanked 68 Times in 34 Posts
    Images: 6

    Question Imported ball Pythons???

    I have been thinking it would be interesting to buy a group of African import ball pythons. I have a seperate room that I could do an extended quarantine in.

    My question is where would I get them?

    Have any of you got imports before? If so any interesting looking snakes?

  2. #2
    BPnet Veteran MmmBanana's Avatar
    Join Date
    03-28-2017
    Posts
    320
    Thanks
    43
    Thanked 197 Times in 126 Posts
    I have never had import ball pythons nor do I think its a good idea. However thats just my opinion. Outback reptiles in northern VA sells imported beeps. Here is a link:

    https://www.outbackreptiles.com/prod...out-of-africa/

  3. #3
    Registered User Joelgriz8124's Avatar
    Join Date
    03-05-2018
    Location
    Boston ma
    Posts
    141
    Thanks
    43
    Thanked 80 Times in 44 Posts

    Re: Imported ball Pythons???

    If you do get imports id be sure the bags aren’t pre opened . Maybe you could get a new morph and end up making s bunch of dough . Imagine if you got a sunset ! They were going for 50k now they are at like 25k


    Sent from my iPhone using Tapatalk

  4. #4
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,944
    Thanks
    893
    Thanked 4,177 Times in 1,550 Posts
    Images: 120

    Re: Imported ball Pythons???

    There is a difference between imported and wild-caught.

    Imported ball pythons are usually raised in huge farms in Africa and obvious abnormalities are screened for potential morphs with a price-tag matching the 'potential'. They aren't going to accidentally give up an obvious new morph for the price of a WT. Sometimes the cost of these potentially new morphs is ridiculously high and do not prove out as genetic. One of the largest producers of captive bred Ball Pythons in the world resides in Africa-rumor has it: he runs a bit of a cartel there with muscle and enforcers and such to 'diminish' the competition in the surrounding regions...I personally would not want to give him my money...

    Wild-caught ball pythons are a different story: but, again-the people who collect them are not stupid and are well aware of the value of unusual patterned/colored snakes in the International Market. Wild-caught ball pythons are subject to any number of potential medical issues and are historically much more difficult to keep than their captive bred offspring.

    For these reasons I don't bother with imports or wild-caught. So many hidden genes floating around in captive ball pythons right now...breed a lot of them and you are bound to spot something unusual...
    *.* TNTC

  5. #5
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: Imported ball Pythons???

    Quote Originally Posted by Lost571 View Post
    I have been thinking it would be interesting to buy a group of African import ball pythons. I have a seperate room that I could do an extended quarantine in.

    My question is where would I get them?

    Have any of you got imports before? If so any interesting looking snakes?
    I can think of plenty of things to put on the "cons" side of the list, but I'm coming up blank on the "pros" side.

    So, out of genuine curiosity, what are some "pros" to this?

  6. #6
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    I'm thinking you'd end up with a lot of expensive normals this way.... with vet bills for worming and treating other issues they may come in with, picky eating, etc. I'd also wonder about having to then re-sell the normals that you have cared for and treated. I would wager you'd loose money on this operation.

    The guy that used to run major league reptiles (or was it major league ball pythons??) used to take on imported animals as possible dinkers. I know he did it with large numbers. But I'm not sure what he did with the many normals he got in. I know I'd see him post possible dinker animals / trios for sale from time to time. I'm thinking he dealt directly with the farm / people catching them and directly imported them.

    There's also a guy on youtube (DM Exotics I think) that shows videos of farms in asia that he buys from. He goes on site to pick out animals. He sometimes talks about the paperwork and other things involved, so that might be useful for you if you are interested in this.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  7. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Imported ball Pythons???

    Someone has already mentioned Outback but I would like to expound on that for a moment.

    Outback most often offers animals that have been farm-hatched from eggs that either came from wild-collected females that were captured, allowed to lay, and then released or eggs dug straight from a burrow (most often the prior). Because these animals were born in captivity - and in many cases sent over before they have even had their first shed - they are not really subject to all the parasite issues and such.

    Occasionally Outback will also offer adult WC animals (like when they get their Volta animals in), these you do need to be ready to deal with a true 'out of the wild' situation. 99% of the time Outback has already done at least a treatment for ectoparasites (ticks, mites, etc.) though I, and they, will advocate that you repeat the process in a couple weeks. You will most likely need to deal with endoparasites with the help of a vet.


    Someone mentioned getting only an unopened bag because it gives you the chance of scoring a huge new morph... I hate to be the bearer of bad news but this is simply never going to happen. The bagged babies have already been through a screening process on the farms in Africa and anything flagrant has already been picked out. You might score something minor like something in the YB complex or a Cinny or something else really subtle but even then the odds are against you, the farm guys know how to spot a morph and they are not going to let anything good slip through. In all likelihood the only thing you will get in the bags is normals. Some may be aberrant looking but they will still be normals.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (05-02-2018),Godzilla78 (05-02-2018)

  9. #8
    Registered User
    Join Date
    08-17-2015
    Location
    Omaha, Nebraska
    Posts
    48
    Thanks
    26
    Thanked 11 Times in 9 Posts
    Images: 1
    Wow, great timing!
    A buddy of mine just got 10 imports in from Outback last night! The total cost was roughly $20 per snake, so it didn't break the bank.

    Pros

    small possibility of finding something unusual or new.... very small possibility (for the reasons folks have listed above)

    Cons
    Possible disease/mites
    Babies are pulled from their eggs and put into bags, very unlikely they've had more than 1 meal (maybe)
    Now you have bulk Normals to house and feed. No bueno.

    All in all I think the whole thing is silly for the average Joe. Unless you're able to pull straight out of the wild, or without tampering there is no point in buying import. You'll end up with a bunch of snakes with maybe Pastel or Mojave, and a lot of possible problems. Might as well save yourself the trouble/money and buy yourself something you actually want.

  10. The Following User Says Thank You to Jaust For This Useful Post:

    Godzilla78 (05-02-2018)

  11. #9
    BPnet Senior Member AbsoluteApril's Avatar
    Join Date
    03-05-2014
    Location
    Utah
    Posts
    2,080
    Thanks
    2,325
    Thanked 2,605 Times in 1,296 Posts

    Re: Imported ball Pythons???

    Quote Originally Posted by Lost571 View Post
    Have any of you got imports before? If so any interesting looking snakes?
    There have been some various threads and posts about people getting those 'unopened bags' of imports, some have vids and pics, here are a few for your reading pleasure:
    https://ball-pythons.net/forums/show...ht-from-Africa
    https://ball-pythons.net/forums/show...9133-Grab-Bags
    and some from fauna, at least one has a response from Josh at Outback:
    http://www.faunaclassifieds.com/foru...d.php?t=654466
    http://www.faunaclassifieds.com/foru...d.php?t=177194
    http://www.faunaclassifieds.com/foru...d.php?t=131027
    ****
    For the Horde!

  12. The Following User Says Thank You to AbsoluteApril For This Useful Post:

    Godzilla78 (05-02-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1