Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 617

0 members and 617 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Results 1 to 3 of 3
  1. #1
    Registered User
    Join Date
    04-15-2018
    Posts
    128
    Thanks
    88
    Thanked 139 Times in 52 Posts
    Images: 4

    Question Mojave 100%het pied x cinnamon 100% het pied?

    Hello my names Brandon i just joined a few days ago currently expanding my breeding collection but anyways i just picked up a pair of cinnamon het pieds, I have the opportunity to buy a female mojave het pied that i can breed to the male cinny , the gentic tool said it can produce savannah pied. When i tried to loook for one i couldnt find it does anyone have experience with this combination?
    Like and follow my page for updates on my projects

    https://m.facebook.com/blureptiles/?ref=bookmarks

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Look for Pied BlackPastel Mojave, basically the same thing. Overall it is going to be a high white Pied, most likely with pigment only on the head and tail areas. Maybe a small spot or two of colour on the body
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    bu998 (04-18-2018)

  4. #3
    Registered User
    Join Date
    04-15-2018
    Posts
    128
    Thanks
    88
    Thanked 139 Times in 52 Posts
    Images: 4

    Re: Mojave 100%het pied x cinnamon 100% het pied?

    Quote Originally Posted by asplundii View Post
    Look for Pied BlackPastel Mojave, basically the same thing. Overall it is going to be a high white Pied, most likely with pigment only on the head and tail areas. Maybe a small spot or two of colour on the body
    Thanks thats what i was looking for what a beautiful combination i think i might get her.
    Like and follow my page for updates on my projects

    https://m.facebook.com/blureptiles/?ref=bookmarks

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1