Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,005

1 members and 2,004 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,080
Threads: 249,221
Posts: 2,572,814
Top Poster: JLC (31,651)
Welcome to our newest member, Rallebon
Results 1 to 6 of 6
  1. #1
    Registered User
    Join Date
    10-20-2015
    Posts
    3
    Thanks
    0
    Thanked 2 Times in 1 Post

    Parthenogenesis in an old BP

    This is an absolutely crazy story, get ready.

    So I work at a zoological facility with a 20+ year old ball python, Kyle, who is used as an education animal (as in he is taken out on programs at the facility, is taken to local schools sometimes, etc). He has been at this facility for 20 years, and was a pet that was surrendered before then. At some point he was probed by an "expert" and said to be male. Well.

    On April 5th we noticed a visible lump in his side, so we sent him to the vet for radiographs (xrays) thinking it might be a mass. Turns out, it's loads of eggs. So apparently Kyle is a girl. He, oops she, hasn't been eating for over a month and we were all worried it might be problems with humidity or temps, or because it's New England winter (even though she's housed inside obviously and we don't brumate or anything. Constant temps all year). Now the lack of eating makes some sense.

    Kyle has lived alone for 20 years and has never been housed with another ball python. We don't know if she was housed with anyone before she came to us, and I know they can retain sperm for several years, but certainly not 20 years, right? That leaves parthenogenesis. Our female corn snake did this to us last spring and laid a clutch of slugs when she's never met a male either, but from what I hear this is much more common in corns. She was also newer to the facility, so she could have been doing this every year for what we know, because we don't know her history. Kyle is just so confusing because after 20 years, what clicked that made her decide to lay eggs?


    So now to my questions:

    I read that BPs usually lay fertile eggs and not many slugs, but what about in this case? I know viable little Kyle clones is possible, but is it likely? I believe the official plan is to pull the eggs and cull them, but we don't breed any animals here so we don't have any protocol as to what to do with unexpected reptile eggs. We are actually short on program snakes right now, so we might attempt to incubate/hatch one or two if any look viable. I know a tad about corn snake breeding, but this is the first BP I have ever dealt with.

    Can you help me figure out a time frame? On the 5th eggs were obvious on radiograph, so that means she's ovulated, but we don't know exactly when. I've been reading up on bp breeding and know to expect a pre-lay shed and count to 25ish days from there, correct? We also don't know if she's passed the pre-lay urate yet. On the 2nd we did find a hard urate in enclosure, so that could have been it, but I'm not sure if that final urate comes this early? The last time she ate was 1 tiny little mouse on March 31. Before that she hadn't eaten since feb. We've been offering her mice weekly. She had normally been a good eater on several f/t mice every 2 weeks. So anyway she obviously hasn't defecated in quite some time. I read that they won't eat when gravid, correct? So I'm guessing we should stop attempting to feed until after eggs? Do you think the lack of eating is all egg-related, or could there have also been something else wrong?

    Lastly, has anyone heard of this before? Any advice from other people with bps that have done this? Know any causes, or something we could do to prevent this in the future?

    Thank you so much! Wish Kyle luck! We have her lay-box all set up!
    Last edited by Shani; 04-08-2018 at 07:33 PM.

  2. The Following 2 Users Say Thank You to Shani For This Useful Post:

    Alter-Echo (04-08-2018),Cloudynight1017 (04-09-2018)

  3. #2
    BPnet Veteran hilabeans's Avatar
    Join Date
    09-26-2017
    Location
    Texas
    Posts
    992
    Thanks
    1,253
    Thanked 1,252 Times in 617 Posts
    Images: 7
    Whoa! That is a crazy story. I know nothing about breeding bps, but imagine none of the eggs are fertile because, how could they be?? Unless she was accepting visitors after hours, the eggs would have to be slugs. Right?

    I mean, they don't fertilize themselves so...

    1.0 Lesser Mojave Ball Python "Neptune"; 1.0 Western Hognose "Murray"

    Lizards:
    1.0 Bearded Dragon "Nigel"

    Tarantulas:
    0.1 G. Rosea "Charlotte"; 0.1 B. Albopilosum "Matilda"; 0.1 C. Versicolor "Bijou"; 1.0 B. Boehmei "Lightening McQueen"

    Inverts:
    1.0 Emperor Scorpion "Boba"

    Dog & Cats:

    1.0 Doberman Pinscher "Bulleit"; 1.0 Siamese Cat "Boudreaux"; 1.0 British Shorthair Cat "Oliver”


    Goats:
    "Hazelnut" & "Huckleberry"


  4. #3
    Registered User
    Join Date
    10-20-2015
    Posts
    3
    Thanks
    0
    Thanked 2 Times in 1 Post

    Re: Parthenogenesis in an old BP

    Female reptiles (and some birds, fish, etc) can self-fertilize. So essentially the offspring are all exact clones of the mother. There's actually an entire species of lizard (several whiptail species, actually) that have done away with males entirely and only self-fertilize. So yes, possible. I know it happens in corn snakes more often than you'd think, but I don't know my pythons like I know my corns, lol.

    https://en.wikipedia.org/wiki/Aspidoscelis

    https://www.scientificamerican.com/a...exual-lizards/

  5. #4
    BPnet Senior Member Tigerhawk's Avatar
    Join Date
    04-25-2013
    Location
    South Carolina
    Posts
    1,779
    Thanks
    1
    Thanked 729 Times in 621 Posts
    Nature will find a way.

  6. #5
    Registered User Scherf's Avatar
    Join Date
    03-19-2018
    Location
    Lex, KY
    Posts
    95
    Thanks
    20
    Thanked 23 Times in 16 Posts
    Yes they can be fertile, you will have to candle light them to see if they are and have developed veins... it’s acutally fairly common for python eggs that are of a parthenogenesis formed to be good eggs. Now for how common it is in balls I have no idea, but for retics, it has been more previlant over the years (from my own research).
    Ball
    1.0 Enchi Lesser Killer Bee
    0.1 Killer King Clown
    0.1 Mystic Potion

    Retic
    1.0 Purple Phase Albino

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Might give this a listen to:

    http://www.blogtalkradio.com/morelia...r-warren-booth

    And it is possible for sperm to be stored for incredibly long time frames
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1