» Site Navigation
2 members and 1,797 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,917
Threads: 249,118
Posts: 2,572,205
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
|
View Poll Results: Paradox or Ringer?
- Voters
- 12. You may not vote on this poll
-
Ringer
-
Paradox
-
Other (please elaborate)
-
Registered User
-
-
BPnet Veteran
To me a Ringer is a when there is a small patch of the the normal pattern washed out with usually a white patch, but I had a yellow belly BP that had a yellow patch. A paradox is more of the appearance of another gene "leaking" through in patches in various degrees on parts of the body. Here are a couple extreme examples below of what comes to mind when I hear the names(none of the pictures below belong to me, they are a result of a quick Google search)
Paradox
https://imgur.com/gallery/Q5IVX
Ringer
https://ballpython.ca/portfolio-posts/ringer/
-
The Following User Says Thank You to Aztec4mia For This Useful Post:
-
Pancake,
Your animal is a ringer.
As far as the difference between the two... Aztec's explanation is pretty close on.
A "ringer" happens when there is a total disruption to pigment deposition on the animal. This occurs in a ventral-to-dorsal manner and is most frequently (but not always) found on the distal half of the animal. Het Pied, especially when in synergy with certain other mutations (e.g., Champ, SuperBlk complex, etc.) does seem to have some correlation in the production of ringers however the presence of a ringer does not necessarily indicate an animal is guaranteed to be het Pied.
"Paradox" is an illegitimate term colloquially used in the hobby to describe any colour/pattern aberration that is outside the expected on a given animal. Examples of this would be an Albino with a patch of WT colouring on it or a Spider with a patch of WT pattern. It is usually the result of localized monoallelic mosaicism or chimerism but can also be the result of a handful of other strange genetic occurrences.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Lord Sorril (04-03-2018),Pancake's Momma (03-06-2018)
-
Ringer is a coloration change usually near the tail that most believe indicates the animal is het for a recessive.
Paradox = Birthmark, that's it.
"Passion Breeds Quality, Quality Breeds Desire" - Tim
-
-
Registered User
Re: Difference between a Ringer and Paradox
Thank you @aztec4mia and @Asplundii for your answers! They are very helpful. ^^
-
-
i thought this was already settled here: https://ball-pythons.net/forums/show...aradox-or-Pied
i own ringers, paradoxes and pieds. your BP is a Pastel het Pied w/ a ringer. u have a lil bit of white and melted pattern there. u have a great looking animal w/ very strong het Pied influences.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 2 Users Say Thank You to Ax01 For This Useful Post:
AbsoluteApril (03-06-2018),Godzilla78 (03-06-2018)
-
Registered User
Re: Difference between a Ringer and Paradox
Yeah, I was mainly wanting to know the difference between a ringer and paradox with this thread, though I realize I didn't make that entirely clear.
-
-
Re: Difference between a Ringer and Paradox
 Originally Posted by Pancake's Momma
Yeah, I was mainly wanting to know the difference between a ringer and paradox with this thread, though I realize I didn't make that entirely clear.
it's just confusing/redundant b/c u are still using your BP for confirmation/affirmation. i'm sorry the breeder misled u but glad the larger community has been able to help u figure out what she is. she is really pretty tho. i like her ringer and reduced pattern.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|