Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 742

0 members and 742 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,103
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 21
  1. #11
    Registered User purepearl's Avatar
    Join Date
    04-30-2017
    Location
    Orlando
    Posts
    32
    Thanks
    14
    Thanked 53 Times in 19 Posts
    I really enjoy watching State48 Exotics videos... could be because Im pretty sure I have a crush on Joel ... but in reality hes just starting out on his breeding program, but hes got some beautiful animals that he likes to show off and talk about, and its been fun to watch him progress.

    I second Viperkeeper as well, I like to put his videos on in the background while Im doing stuff around the house. Its entertaining to hear a fully grown man talk to some of his snakes the way Al does. I feel like *for the most part* he also promotes smart and safe handling of his hots, which I think is important.
    Stephanie

    Pure Pearl Pythons

    http://www.instagram.com/purepearlpythons

    0.1 Champagne Cinnamon
    0.1 Reduced Normal
    0.1 Bamboo
    0.1 Pewter
    0.1 Pastel Pied
    1.0 Super Cinnamon
    1.0 Banana

  2. #12
    Anti-Thread Necro Patrol
    Join Date
    05-10-2007
    Location
    Columbus, Georgia, United States
    Posts
    4,561
    Thanks
    334
    Thanked 1,230 Times in 739 Posts
    Blog Entries
    1
    Images: 51
    SnakeBytes /AnimalBytes. Surprised that hasn't been mentioned that I could see.

    And while not 100% reptiles, Brave Wilderness is amazing all around animal content.
    - Mason

  3. #13
    BPnet Veteran JRLongton's Avatar
    Join Date
    02-27-2017
    Location
    Attleboro, Massachusetts
    Posts
    378
    Thanks
    527
    Thanked 408 Times in 228 Posts
    Images: 12

    Re: Any Good Youtube Reptile Channels?

    I particularly like Snake Discovery. Emily has tons of charisma and is a great spokesperson for the hobby.

    I also really enjoy Dav Kaufman with the Reptile Channel. He has this cool eccentric vibe that I enjoy. I get such a kick everytime the show begins with Rainbow Mealworms presents.... I never before imagined mealworms being branded, let alone sponsoring a show!

    I used to watch the Viper Keeper, in fact it was his videos that reignited my interest in snake-keeping. But it just got so repetitive. He has all these beautiful and fascinating snakes, but he never really gives any detail on them. He just says its a such and such, and then we watch in silence as he feeds it a thawed mouse. Every episode is a huge missed opportunity to educate a clearly interested audience.

    I also don't like that he is constantly having shedding issues. I'm a rank novice to be sure, but as I understand it, difficulties shedding are indicative of health/stress problems.

    thanks for the commentary on the other youtubers. I'm always looking for new snake videos to watch!

  4. #14
    BPnet Veteran Valyrian's Avatar
    Join Date
    01-19-2018
    Location
    Nottingham, UK
    Posts
    391
    Thanks
    349
    Thanked 280 Times in 153 Posts
    Images: 15

    Re: Any Good Youtube Reptile Channels?

    Quote Originally Posted by JRLongton View Post
    I particularly like Snake Discovery. Emily has tons of charisma and is a great spokesperson for the hobby.

    I also really enjoy Dav Kaufman with the Reptile Channel. He has this cool eccentric vibe that I enjoy. I get such a kick everytime the show begins with Rainbow Mealworms presents.... I never before imagined mealworms being branded, let alone sponsoring a show!

    I used to watch the Viper Keeper, in fact it was his videos that reignited my interest in snake-keeping. But it just got so repetitive. He has all these beautiful and fascinating snakes, but he never really gives any detail on them. He just says its a such and such, and then we watch in silence as he feeds it a thawed mouse. Every episode is a huge missed opportunity to educate a clearly interested audience.

    I also don't like that he is constantly having shedding issues. I'm a rank novice to be sure, but as I understand it, difficulties shedding are indicative of health/stress problems.

    thanks for the commentary on the other youtubers. I'm always looking for new snake videos to watch!
    I just checked out The Viper Keeper and have to say that his intro seems a bit reckless. Also not sure it's a good idea not having locks on enclosures containing venomous snakes but I guess he's the expert lol. I have a feeling it's a case of 'when' rather than 'if' he gets bitten.
    0.1 CB17 Pearl Burmese Python - Kaiju

  5. #15
    Anti-Thread Necro Patrol
    Join Date
    05-10-2007
    Location
    Columbus, Georgia, United States
    Posts
    4,561
    Thanks
    334
    Thanked 1,230 Times in 739 Posts
    Blog Entries
    1
    Images: 51

    Re: Any Good Youtube Reptile Channels?

    Quote Originally Posted by Valaryan View Post
    I just checked out The Viper Keeper and have to say that his intro seems a bit reckless. Also not sure it's a good idea not having locks on enclosures containing venomous snakes but I guess he's the expert lol. I have a feeling it's a case of 'when' rather than 'if' he gets bitten.
    I don't think he's worried about anyone stealing them.
    - Mason

  6. #16
    BPnet Veteran Aztec4mia's Avatar
    Join Date
    12-28-2009
    Location
    Cali
    Posts
    263
    Thanks
    7
    Thanked 80 Times in 60 Posts
    I just checked out The Viper Keeper and have to say that his intro seems a bit reckless. Also not sure it's a good idea not having locks on enclosures containing venomous snakes but I guess he's the expert lol. I have a feeling it's a case of 'when' rather than 'if' he gets bitten.
    He has older videos that touch on both your concerns.

  7. #17
    BPnet Veteran Valyrian's Avatar
    Join Date
    01-19-2018
    Location
    Nottingham, UK
    Posts
    391
    Thanks
    349
    Thanked 280 Times in 153 Posts
    Images: 15

    Re: Any Good Youtube Reptile Channels?

    Quote Originally Posted by MasonC2K View Post
    I don't think he's worried about anyone stealing them.
    I think they'll get out.

    - - - Updated - - -

    Quote Originally Posted by Aztec4mia View Post
    He has older videos that touch on both your concerns.
    Thanks, I'll check them out.
    0.1 CB17 Pearl Burmese Python - Kaiju

  8. #18
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts

    Re: Any Good Youtube Reptile Channels?

    Quote Originally Posted by Valaryan View Post
    I just checked out The Viper Keeper and have to say that his intro seems a bit reckless. Also not sure it's a good idea not having locks on enclosures containing venomous snakes but I guess he's the expert lol. I have a feeling it's a case of 'when' rather than 'if' he gets bitten.
    I believe I've seen him use shims (wooden shims) in the glass doors to prevent them from sliding until he removes them. I did notice in a recent video that there wasn't a shim in place, but maybe he's removing them now before filming or isn't using them anymore. I do like that there is a verbal warning about keeping hots in his intro, but agree about the "dramatics". I've only occasionally watched him. I agree that I wish he talked more about each species while working with them it would make it a lot more educational.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  9. #19
    BPnet Veteran pretends2bnormal's Avatar
    Join Date
    09-07-2017
    Posts
    861
    Thanks
    713
    Thanked 1,179 Times in 575 Posts
    Images: 7

    Re: Any Good Youtube Reptile Channels?

    Quote Originally Posted by artgecko View Post
    I believe I've seen him use shims (wooden shims) in the glass doors to prevent them from sliding until he removes them. I did notice in a recent video that there wasn't a shim in place, but maybe he's removing them now before filming or isn't using them anymore. I do like that there is a verbal warning about keeping hots in his intro, but agree about the "dramatics". I've only occasionally watched him. I agree that I wish he talked more about each species while working with them it would make it a lot more educational.
    I don't recall which video, but one I saw a few weeks ago (probably an old one since I'm not watching in order), but he explained that the pieces of wood he puts in the glass weren't for holding the doors shut at all. They're to keep the glass from rattling if or when an agitated snake strikes at it.

    If the glass can't rattle, it would be less noisy for both video and personal sanity imo.

    Sent from my SM-G950U using Tapatalk

  10. The Following User Says Thank You to pretends2bnormal For This Useful Post:

    Valyrian (03-07-2018)

  11. #20
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    'From the Ground Up' does their weekly show live on YouTube. I more listen to them as podcasts but occasionally load up the show when I am stuck in the lab
    Last edited by asplundii; 03-07-2018 at 09:17 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1