Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,353

0 members and 1,353 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,936
Threads: 249,129
Posts: 2,572,284
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    Registered User
    Join Date
    02-05-2018
    Posts
    6
    Thanks
    13
    Thanked 1 Time in 1 Post

    Question Albino BP Eye Question : Slightly worried

    Hi all! I bought my first BP a few weeks ago and she is amazing! Currently aged at around 5 or 6 months but could really do with some advice from you all.

    I've always noticed her eye colour which is slightly white at the top half of her eyes, both left and right side. It doesn't look like retained eye caps from shed or anything, but possibly a permanent marking on her eyes. Can any albino BP owners confirm if their BP's have similar markings or any other experienced BP owners confirm if this is ok or a health issue like a cataract? My understanding was that their eyes should be pretty clear all over.

    Her eyes are working pretty fine, does what a young BP should do, when my hand goes near her she might move back a bit same with walking past her enclosure, any sudden movements she springs back, eats fine, has never bitten me etc..

    I have attached a link to the pictures I have managed to get, hopefully they are clear enough for you guys to identify. Any help or advice would be appreciated. Thanks and have a great day!

    https://imgur.com/a/nkorV - not the greatest quality pic sorry

    Jay

  2. #2
    BPnet Veteran Tonald Drump's Avatar
    Join Date
    10-23-2017
    Posts
    364
    Thanks
    97
    Thanked 128 Times in 84 Posts

    Re: Albino BP Eye Question : Slightly worried

    I'm no expert, but those look like markings. They definitely don't look unnatural or strange to me, but as I said, I'm no expert, so take this with a pinch of salt

    Sent from my vivo 1601 using Tapatalk

  3. The Following 2 Users Say Thank You to Tonald Drump For This Useful Post:

    CALM Pythons (02-06-2018),jay127 (02-06-2018)

  4. #3
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Albino BP Eye Question : Slightly worried

    Thats cool but out of the 3 Albinos I've owned their eyes were/are completely Red.
    I do find mine see terrible, except for the Burm.. He's never had a problem seeing. The others react like they can only see so far and will even startle them self banging into something they didnt notice until they hit it with their face. Hahaha.
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  5. The Following User Says Thank You to CALM Pythons For This Useful Post:

    jay127 (02-06-2018)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I cannot view your link (pretty strict firewall here at work) but I am fairly certain I know what you are referring to -- The eye on Albinos often has a bicolour look to it, a lighter pinkish, almost prismatic on the top half. This is perfectly normal and all my Albinos and Candinos have this.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    jay127 (02-06-2018)

  8. #5
    Registered User
    Join Date
    02-05-2018
    Posts
    6
    Thanks
    13
    Thanked 1 Time in 1 Post
    You guys are awesome. Thanks for all weighing in here. To me it just looks like markings. Asplundii thanks for confirming too. If you do get a chance to have a little look at the link once your back from home, it'd put my mind more at ease

    Thank you all again!

  9. #6
    BPnet Veteran
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    297
    Thanks
    149
    Thanked 196 Times in 105 Posts
    Natural markings.

  10. The Following User Says Thank You to Reptilius For This Useful Post:

    jay127 (02-07-2018)

  11. #7
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by asplundii View Post
    I cannot view your link (pretty strict firewall here at work) but I am fairly certain I know what you are referring to -- The eye on Albinos often has a bicolour look to it, a lighter pinkish, almost prismatic on the top half. This is perfectly normal and all my Albinos and Candinos have this.
    Is this something newer? None of mine have that..however mine are all Old School albino's, starting as long as 21 years ago.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  12. The Following User Says Thank You to CALM Pythons For This Useful Post:

    jay127 (02-07-2018)

  13. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by CALM Pythons View Post
    Is this something newer? None of mine have that..however mine are all Old School albino's, starting as long as 21 years ago.
    Again, without having seen the the OP's pic I can not say for certain I know what she is talking about but if it is what I believe then no, it is not something new it is just the way their eyes are. See the pics below, all of them have a lighter region on the top portion of their eye:

    http://www.worldofballpythons.com/fi...-clown/001.jpg
    http://www.bobclark.com/static/upload/1423610607.jpg
    https://i.pinimg.com/originals/92/5a...13557adb8e.jpg
    http://www.urbanalbino.com/yahoo_sit...1249_large.jpg


    Quote Originally Posted by jay127 View Post
    Asplundii thanks for confirming too. If you do get a chance to have a little look at the link once your back from home, it'd put my mind more at ease
    I will try to remember to log on when I get home this evening and look at your image directly.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. #9
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Albino BP Eye Question : Slightly worried

    Quote Originally Posted by asplundii View Post
    Again, without having seen the the OP's pic I can not say for certain I know what she is talking about but if it is what I believe then no, it is not something new it is just the way their eyes are. See the pics below, all of them have a lighter region on the top portion of their eye:

    http://www.worldofballpythons.com/fi...-clown/001.jpg
    http://www.bobclark.com/static/upload/1423610607.jpg
    https://i.pinimg.com/originals/92/5a...13557adb8e.jpg
    http://www.urbanalbino.com/yahoo_sit...1249_large.jpg




    I will try to remember to log on when I get home this evening and look at your image directly.
    I think his is the same just his is more pronounced. Ive never had that in any of mine as i said.. And I certainly don't remember that being in albinos 20 years ago. here is his pic.



    Sent from my iPhone using Tapatalk
    Last edited by CALM Pythons; 02-07-2018 at 09:29 AM.
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  15. The Following User Says Thank You to CALM Pythons For This Useful Post:

    jay127 (02-07-2018)

  16. #10
    Registered User
    Join Date
    02-05-2018
    Posts
    6
    Thanks
    13
    Thanked 1 Time in 1 Post
    Thanks calm for adding the picture, appreciate it.

    And the last link that asplundii postes is pretty much identical to what mine has. Thanks for the time in getting those pics guys.

    A bit strange you've never seem them before calm, perhaps it could be the ages of the snakes you have and could certainly be only affecting newer snakes. Who knows! But again this has put my mind at ease. Bless you giys for the advice and help
    Last edited by jay127; 02-07-2018 at 11:19 AM.

  17. The Following User Says Thank You to jay127 For This Useful Post:

    CALM Pythons (02-07-2018)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1