» Site Navigation
1 members and 786 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
|
-
Best first tarantula
I’ve always though spiders were cool. What’s the best first tarantula as far as handleabilty and care? Thanks!
Sent from my iPhone using Tapatalk
1.0 Normal BP
1.0 Mainland Reticulated
1.0 High lines Red Tail Boa
-
-
Registered User
Re: Best first tarantula
Rosehairs are usually the ones recommended for beginners. That was my first one very handable and didn't hair me.
-
The Following 2 Users Say Thank You to Morgoth For This Useful Post:
c0r3yr0s3 (01-16-2018),dylan815 (01-16-2018)
-
I have a rose hair and she's lovely. Super tolerant of handling, though I don't do it much. If I were to get another I think I'd go for a pink toe. They are freaking adorable!

1.0 Lesser Mojave Ball Python "Neptune"; 1.0 Western Hognose "Murray"
Lizards:
1.0 Bearded Dragon "Nigel"
Tarantulas:
0.1 G. Rosea "Charlotte"; 0.1 B. Albopilosum "Matilda"; 0.1 C. Versicolor "Bijou"; 1.0 B. Boehmei "Lightening McQueen"
Inverts:
1.0 Emperor Scorpion "Boba"
Dog & Cats:
1.0 Doberman Pinscher "Bulleit"; 1.0 Siamese Cat "Boudreaux"; 1.0 British Shorthair Cat "Oliver”
Goats:
"Hazelnut" & "Huckleberry"
-
The Following User Says Thank You to hilabeans For This Useful Post:
-
Registered User
Re: Best first tarantula
Hi there! I highly recommend checking out the arachnoboards forum. Its chalk full of information on anything tarantula. Not sure how much research you've done so I'll just list a couple with common and scientific name.
For a first T i would suggest any of these (google for pics):
Green bottle blue - Chromatopelma cyaneopubescens
Honduran curly hair -Brachypelma albopilosum
Mexican red knee- brachypelma hamori
Arizona blonde- aphonopelma chalcodes
Theres tons out there, so see what you like, and if the care they need fits your desires.
Sent from my SM-G930V using Tapatalk
-
-
If you want something to handle, you basically cut out most of the old world species - them the ones that tend to have nastier attitudes and more potent venom. Out of the new world stuff, I feel like the Brachypelma and Grammostola genera have the most to offer new tarantula keepers looking for a handleable pet. Here are some of the more commonly recommended.
B. smithi
B. vagans
B. emilia
G. rosea
Bear in mind that personalities vary and you can get a particularly nasty animal of any species. On average though, most of the above are pretty laid back critters. You might consider buying an older female(don't worry, the gals live decades) from someone who has already raised it up from a sling and therefore knows it's temperament. Slings can be a little delicate anyway so if you want to raise one up from a few instar(number of molts from egg), I recommend getting a little keeping experience first. I'd also steer clear of arboreal stuff for a first time tarantula. While they might not be prone to bite(Avicularia are pretty laid back and hugely popular), they can be jumpers and just a bit unwieldy for new keepers.
-
-
My ex picked up a Acanthoscurria geniculata that I have since inherited. Super easy to care for, eats like a pig (seriously, she will literally eat until she explodes if you let her), handles alright though I do not do it frequently as I am hyper-reactive to the urticating hairs.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Best first tarantula
 Originally Posted by John1982
Out of the new world stuff, I feel like the Brachypelma and Grammostola genera have the most to offer new tarantula keepers looking for a handleable pet.
Grammostola pulchra / Brazilian Black Tarantula for sure. Large, relatively docile, and easy to care for.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|