» Site Navigation
1 members and 659 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,117
Top Poster: JLC (31,651)
|
-
Has anyone here used C_Cerpents rack systems?
-
-
Best racks, best lead time and best customer service around when it comes to PVC racks.
Combo racks will be useless very fast when it comes to growing BP as the first 5 shelves will only allow you to house BP up to 600 grams.
The last 2 will last longer and allow you to house BP until they 2000 grams.
V15 tubs are for hatchling colubrids
V18 Hatchling BP up to 600 grams
V35 S BP up to 600 grams (due to height) or adult colubrids
V35 are for adult BP up to 2000 grams and adult colubrids.
-
The Following 3 Users Say Thank You to Stewart_Reptiles For This Useful Post:
Craiga 01453 (01-23-2018),Godzilla78 (03-08-2018),Roux (01-23-2018)
-
Re: Has anyone here used C_Cerpents rack systems?
 Originally Posted by Deborah
Best racks, best lead time and best customer service around when it comes to PVC racks.
Combo racks will be useless very fast when it comes to growing BP as the first 5 shelves will only allow you to house BP up to 600 grams.
The last 2 will last longer and allow you to house BP until they 2000 grams.
V15 tubs are for hatchling colubrids
V18 Hatchling BP up to 600 grams
V35 S BP up to 600 grams (due to height) or adult colubrids
V35 are for adult BP up to 2000 grams and adult colubrids.
Thinking about ordering one on the 1st.
-
-
I have 4 C-Serpents racks and have been quite happy with them. If they vend a show near you it might be an easier way to get your hands on one and save you a bit in shipping costs
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Has anyone here used C_Cerpents rack systems?
 Originally Posted by asplundii
I have 4 C-Serpents racks and have been quite happy with them. If they vend a show near you it might be an easier way to get your hands on one and save you a bit in shipping costs
There is a reptile expo this weekend but I don't get paid till the Wed after.
-
-
Registered User
Re: Has anyone here used C_Cerpents rack systems?
Just curious Deborah, is there anything specific about the C serpent rack over say a vivarium electronics rack that makes them superior? They look nearly identical with one having 3 inch and the other 4 inch tape.
cheers,
gabe gartner
-
-
Re: Has anyone here used C_Cerpents rack systems?
 Originally Posted by gabrielgartner
Just curious Deborah, is there anything specific about the C serpent rack over say a vivarium electronics rack that makes them superior? They look nearly identical with one having 3 inch and the other 4 inch tape.
cheers,
gabe gartner
The tubs are a different brand but of the same design and quality now, everything else seems similar based on seing the newly redesign RB racks in person recently.
Main reason I have C Serpent is that compare to the old RB racks they were superior and had more choices but now they are equally as good and offer more choices as well.
I am also fortunate to be able to pickup my racks in person which has allowed me to get some custom racks from Chris that I would not have been able to get otherwise.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Re: Has anyone here used C_Cerpents rack systems?
 Originally Posted by Deborah
Best racks, best lead time and best customer service around when it comes to PVC racks.
Combo racks will be useless very fast when it comes to growing BP as the first 5 shelves will only allow you to house BP up to 600 grams.
The last 2 will last longer and allow you to house BP until they 2000 grams.
V15 tubs are for hatchling colubrids
V18 Hatchling BP up to 600 grams
V35 S BP up to 600 grams (due to height) or adult colubrids
V35 are for adult BP up to 2000 grams and adult colubrids.
Thanks for this info! I’ve been thinking of getting a rack set up also and was between the Reptile Basics VE racks and the ones at C Serpents.
-
-
Re: Has anyone here used C_Cerpents rack systems?
One question. What is the best way to mount the thermostat probe on the C Serpents systems? I’ve seen videos where people drill a hole in the back panel to thread the probe through. Just wondering if there is a better way to do it.
-
-
Re: Has anyone here used C_Cerpents rack systems?
 Originally Posted by Sgt7212
One question. What is the best way to mount the thermostat probe on the C Serpents systems? I’ve seen videos where people drill a hole in the back panel to thread the probe through. Just wondering if there is a better way to do it.
That was what I did, quick hit with the drill and thread the probe in. Alternately you could pull a few of the screws off the back, enough to let you slide the probe in, and then replace the screws
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|