Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 737

2 members and 735 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,113
Posts: 2,572,175
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 4 of 4 FirstFirst 1234
Results 31 to 38 of 38
  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have yet to see a SuperRusso that did not develop a dorsal stripe. I will go one further and say I have witnessed the presence of a dorsal stripe in every super form of BluEL but the frequency and visibility of it is less likely with the strongest alleles in the group (e.g., Lesser, Butter, and possibly Bamboo) but the trade off is that the supers in the stronger alleles tend toward bug-eye
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (01-12-2018),CALM Pythons (01-12-2018)

  3. #32
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: New Addition. Russo White Diamond (BEL)

    Quote Originally Posted by Ax01 View Post
    she looks kinda like a Pastel Champagne. what exactly was the pairing that produced her. the dam is a White Diamond, what was the sire - a Russo something? i would get her under a black light. maybe u will discover some cool patterns.



    the "White Diamond" in that pix also has a buggy left eye. i wonder how common that might be. although this is a small sample, but this discussion is leading me to believe the White Diamond's rep as the purest white snake ain't really all that (unless there's something else at play and they aren't pure Super Russo's (White Diamond) ).

    Edit: i hope Hannah, our resident BEL-complex superfan, will find this thread and chime in.
    Im late to the party! Didnt read every reply but will add my 2 cents. I have NEVER seen an all white super russo( im sure some have less striping than others). I honestly dont know why people claim theyre the whitest of white. I think the whole "white diamond" thing puts things in peoples heads. Here are a few pictures of my 2000g girl and she has a noticeable stripe along with pattern under black light. I dont know what that breeder was talking about as far as the stripe lessening when they do the opposite with age.

    Sent from my SM-G920T using Tapatalk

  4. The Following 3 Users Say Thank You to Hannahshissyfix For This Useful Post:

    Ax01 (01-12-2018),CALM Pythons (01-12-2018),Godzilla78 (01-12-2018)

  5. #33
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: New Addition. Russo White Diamond (BEL)

    And as far as what id say are generally the whitest whites of BPs, my Super Lesser is solid white with no striping under black light and my girl has normal eyes but i won't produce more and risk making them buggy. The other closest to white is this pastel lesser mojave i produced which has just the faintest stripe. Crappy picture but i just pulled them out real quick to take a picture in natural light before our snow storm hits.


    Sent from my SM-G920T using Tapatalk

  6. The Following User Says Thank You to Hannahshissyfix For This Useful Post:

    CALM Pythons (01-24-2018)

  7. #34
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: New Addition. Russo White Diamond (BEL)

    Quote Originally Posted by HannahLou View Post
    And as far as what id say are generally the whitest whites of BPs, my Super Lesser is solid white with no striping under black light and my girl has normal eyes but i won't produce more and risk making them buggy. The other closest to white is this pastel lesser mojave i produced which has just the faintest stripe. Crappy picture but i just pulled them out real quick to take a picture in natural light before our snow storm hits.


    Sent from my SM-G920T using Tapatalk
    Hanna thank you for your replies.. Well I'm a Pet guy so I'm now over the fact she isn't pure white..what gets me is what Vin says about them. He sure seems like a great person, but what he told me is all wrong and i have each of his emails where he said it all.. If I was a Hot Head id call him out on it but I just assume enjoy my snakes and learn. I will however tell anyone that wants a pure white snake not to buy a White Diamond thats for sure.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  8. The Following 2 Users Say Thank You to CALM Pythons For This Useful Post:

    Godzilla78 (01-12-2018),Hannahshissyfix (01-12-2018)

  9. #35
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: New Addition. Russo White Diamond (BEL)

    Quote Originally Posted by Mr Sully View Post
    Hanna thank you for your replies.. Well I'm a Pet guy so I'm now over the fact she isn't pure white..what gets me is what Vin says about them. He sure seems like a great person, but what he told me is all wrong and i have each of his emails where he said it all.. If I was a Hot Head id call him out on it but I just assume enjoy my snakes and learn. I will however tell anyone that wants a pure white snake not to buy a White Diamond thats for sure.


    Sent from my iPhone using Tapatalk
    Oh wow somehow i missed your communication was with Mr Russo himself. Well, I've never heard much but positive about him so all I can think is that maybe its a case of a parents blind eye and all of their babies are the cutest regardless what others see

    Sent from my SM-G920T using Tapatalk

  10. The Following User Says Thank You to Hannahshissyfix For This Useful Post:

    CALM Pythons (01-12-2018)

  11. #36
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: New Addition. Russo White Diamond (BEL)

    Quote Originally Posted by HannahLou View Post
    Oh wow somehow i missed your communication was with Mr Russo himself. Well, I've never heard much but positive about him so all I can think is that maybe its a case of a parents blind eye and all of their babies are the cutest regardless what others see

    Sent from my SM-G920T using Tapatalk
    Yup I talked to him for over a year about these.. And then was on the list since fall of 2016. He lives here in NY and has a great reputation and is a nice guy to boot.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  12. #37
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: New Addition. Russo White Diamond (BEL)

    Snuggle
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  13. The Following User Says Thank You to CALM Pythons For This Useful Post:

    zina10 (01-25-2018)

  14. #38
    Registered User Destanie's Avatar
    Join Date
    01-15-2018
    Location
    Taft Ca.
    Posts
    32
    Thanks
    72
    Thanked 4 Times in 4 Posts

    Re: New Addition. Russo White Diamond (BEL)

    Very beautiful!

  15. The Following User Says Thank You to Destanie For This Useful Post:

    CALM Pythons (01-25-2018)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1