Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,793

3 members and 1,790 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,050
Threads: 249,210
Posts: 2,572,716
Top Poster: JLC (31,651)
Welcome to our newest member, Urceolate
Results 1 to 10 of 10
  1. #1
    Registered User
    Join Date
    12-26-2017
    Posts
    11
    Thanks
    1
    Thanked 0 Times in 0 Posts

    Is it common for a single female bp to lay eggs?

    Just curious, will a female ball python lay eggs without mating? I've heard some reptiles do this, and can even self fertilize eggs. I think I read somewhere that bps can do this I'm just not sure how common it is.

  2. #2
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    it's called parthenogenesis and it's extremely rare. i don't have the stats but u can search the forum or google it. i think most owners who think it's a miracle (or parthenogenesis) with their newly acquired BP/snake, it's actually probably retained sperm from previous pairings or owners. asexual reproduction is how Mourning Gecko's reproduce tho as there are only females.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  3. The Following User Says Thank You to Ax01 For This Useful Post:

    Stewart_Reptiles (01-09-2018)

  4. #3
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    Extremely rare in Ball Pythons, more common with some lizard species, the few parthenogenesis I have heard about with BP are highly questionable (keep in mind they can retain sperm for quite a while)
    Deborah Stewart


  5. #4
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,596
    Thanks
    3,013
    Thanked 10,059 Times in 4,862 Posts
    Images: 34
    I have a female that was paired in 2013 and dropped eggs in 2014. She has never been paired since then. She's a friendly normal so I was hanging on to her as a pet.

    This past spring she gave me a clutch of four eggs, 2 male 2 female so definitely not parthogenesis. That's a long time to retain sperm but she did it.

  6. The Following User Says Thank You to bcr229 For This Useful Post:

    Godzilla78 (01-09-2018)

  7. #5
    BPnet Veteran Kcl's Avatar
    Join Date
    07-07-2016
    Posts
    433
    Thanks
    595
    Thanked 431 Times in 244 Posts
    Images: 27

    Re: Is it common for a single female bp to lay eggs?

    It's thought to be very rare in ball pythons, but determining any more accurately than that would be difficult, as some snake species have been observed to have parthenogenetic offspring years after having sexually produced offspring. The difference between these was proven via DNA testing to rule out sperm retention. However, it has also been proven via DNA testing that parthenogenesis occurs in the Burmese python, so it's a fairly safe assumption that ball pythons can reproduce in this manner.

    It's possible that more specific information will come out in the coming years, as it has just recently been shown that Boidae and Pythonidae have the XY system of inheritance (homozygous females) vs the ZW system (heterozygous females). That means that many of the previous theories as to how parthenogenesis was occurring in many of these species were incorrect. The current belief is that snake families that produce females only with parthenogenesis - Alethinophidia (incl. blind snakes), Boidae and Pythonidae - are XY while snake families that produce males only with parthenogenesis - Colubroidea (incl. colubrids, elapids, and vipers) - are ZW.

    Obligate parthenogenesis is found in brahminy blind snakes, which are triploid and all female.

    1.0 Pastel yellowbelly ball python -Pipsy
    2.0 Checkered garter snakes - Hazama & Relius
    1.0 Dumeril's boa - Bazil

  8. The Following User Says Thank You to Kcl For This Useful Post:

    Alicia (01-09-2018)

  9. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    People make the claim that it is exceedingly rare but work done by people like Dr. Booth would indicate that parthenogenesis is actually relatively common. There is some indication that the process still requires at least some degree of exposure to a male so a female that has never seen a male is less likely to spontaneously produce a clutch, but there are still cases of it happening
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #7
    Registered User Timelugia's Avatar
    Join Date
    05-15-2015
    Posts
    183
    Thanks
    495
    Thanked 92 Times in 59 Posts

    Re: Is it common for a single female bp to lay eggs?

    Quote Originally Posted by asplundii View Post
    People make the claim that it is exceedingly rare but work done by people like Dr. Booth would indicate that parthenogenesis is actually relatively common. There is some indication that the process still requires at least some degree of exposure to a male so a female that has never seen a male is less likely to spontaneously produce a clutch, but there are still cases of it happening
    Can you post a link to Dr. Booth's work? I'd be interested in reading it

  11. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is it common for a single female bp to lay eggs?

    Quote Originally Posted by Timelugia View Post
    Can you post a link to Dr. Booth's work? I'd be interested in reading it
    https://www.booth-lab.org/
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Alicia (01-11-2018),Kcl (01-11-2018)

  13. #9
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Remember Jurassic Park? They made all the dinosaurs females, but they forgot about Parthenogenesis and they actually laid eggs without males LOL.

    From what I understand, if you have a multigene female that undergoes parthenogenesis all of the babies will be the same morph combo as the female laying eggs. If it's retained sperm you will get a whole variety of morph combos in the offspring. A bit more difficult to determine if the original female is a normal.


  14. The Following User Says Thank You to cchardwick For This Useful Post:

    CALM Pythons (01-16-2018)

  15. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is it common for a single female bp to lay eggs?

    Quote Originally Posted by cchardwick View Post
    From what I understand, if you have a multigene female that undergoes parthenogenesis all of the babies will be the same morph combo as the female laying eggs.
    Not entirely correct.

    If a female undergoes parthenogenesis then the babies will be homozygous at the mutation locus. So if, for example, you have a Lesser female lay a partho clutch then the babies will be either WT or SuperLessers. Or if you have a het Albino female lay a partho clutch then the babies will be either WT or Albino.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1