» Site Navigation
0 members and 1,630 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,090
Threads: 249,228
Posts: 2,572,846
Top Poster: JLC (31,651)
|
-
Registered User
Is it common for a single female bp to lay eggs?
Just curious, will a female ball python lay eggs without mating? I've heard some reptiles do this, and can even self fertilize eggs. I think I read somewhere that bps can do this I'm just not sure how common it is.
-
-
it's called parthenogenesis and it's extremely rare. i don't have the stats but u can search the forum or google it. i think most owners who think it's a miracle (or parthenogenesis) with their newly acquired BP/snake, it's actually probably retained sperm from previous pairings or owners. asexual reproduction is how Mourning Gecko's reproduce tho as there are only females.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
-
Extremely rare in Ball Pythons, more common with some lizard species, the few parthenogenesis I have heard about with BP are highly questionable (keep in mind they can retain sperm for quite a while)
-
-
I have a female that was paired in 2013 and dropped eggs in 2014. She has never been paired since then. She's a friendly normal so I was hanging on to her as a pet.
This past spring she gave me a clutch of four eggs, 2 male 2 female so definitely not parthogenesis. That's a long time to retain sperm but she did it.
-
The Following User Says Thank You to bcr229 For This Useful Post:
-
Re: Is it common for a single female bp to lay eggs?
It's thought to be very rare in ball pythons, but determining any more accurately than that would be difficult, as some snake species have been observed to have parthenogenetic offspring years after having sexually produced offspring. The difference between these was proven via DNA testing to rule out sperm retention. However, it has also been proven via DNA testing that parthenogenesis occurs in the Burmese python, so it's a fairly safe assumption that ball pythons can reproduce in this manner.
It's possible that more specific information will come out in the coming years, as it has just recently been shown that Boidae and Pythonidae have the XY system of inheritance (homozygous females) vs the ZW system (heterozygous females). That means that many of the previous theories as to how parthenogenesis was occurring in many of these species were incorrect. The current belief is that snake families that produce females only with parthenogenesis - Alethinophidia (incl. blind snakes), Boidae and Pythonidae - are XY while snake families that produce males only with parthenogenesis - Colubroidea (incl. colubrids, elapids, and vipers) - are ZW.
Obligate parthenogenesis is found in brahminy blind snakes, which are triploid and all female.
1.0 Pastel yellowbelly ball python -Pipsy
2.0 Checkered garter snakes - Hazama & Relius
1.0 Dumeril's boa - Bazil
-
The Following User Says Thank You to Kcl For This Useful Post:
-
People make the claim that it is exceedingly rare but work done by people like Dr. Booth would indicate that parthenogenesis is actually relatively common. There is some indication that the process still requires at least some degree of exposure to a male so a female that has never seen a male is less likely to spontaneously produce a clutch, but there are still cases of it happening
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Is it common for a single female bp to lay eggs?
 Originally Posted by asplundii
People make the claim that it is exceedingly rare but work done by people like Dr. Booth would indicate that parthenogenesis is actually relatively common. There is some indication that the process still requires at least some degree of exposure to a male so a female that has never seen a male is less likely to spontaneously produce a clutch, but there are still cases of it happening
Can you post a link to Dr. Booth's work? I'd be interested in reading it
-
-
Re: Is it common for a single female bp to lay eggs?
 Originally Posted by Timelugia
Can you post a link to Dr. Booth's work? I'd be interested in reading it
https://www.booth-lab.org/
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Alicia (01-11-2018),Kcl (01-11-2018)
-
Remember Jurassic Park? They made all the dinosaurs females, but they forgot about Parthenogenesis and they actually laid eggs without males LOL.
From what I understand, if you have a multigene female that undergoes parthenogenesis all of the babies will be the same morph combo as the female laying eggs. If it's retained sperm you will get a whole variety of morph combos in the offspring. A bit more difficult to determine if the original female is a normal.
-
The Following User Says Thank You to cchardwick For This Useful Post:
CALM Pythons (01-16-2018)
-
Re: Is it common for a single female bp to lay eggs?
 Originally Posted by cchardwick
From what I understand, if you have a multigene female that undergoes parthenogenesis all of the babies will be the same morph combo as the female laying eggs.
Not entirely correct.
If a female undergoes parthenogenesis then the babies will be homozygous at the mutation locus. So if, for example, you have a Lesser female lay a partho clutch then the babies will be either WT or SuperLessers. Or if you have a het Albino female lay a partho clutch then the babies will be either WT or Albino.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|