» Site Navigation
0 members and 779 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,717
Top Poster: JLC (31,651)
|
-
Registered User
Albino morphs that hold their pattern and color.
So my girlfriends nephew wants a ball python and of course I got real excited and started showing him all different kinds of morphs. He really likes albinos but I know with age most seem to just turn yellow so I was wondering if there were any morphs that keep their pattern as they age.
-
-
I heard albino with GHI hold color and toffinos also hold theirs best wishes
Domestic Short Hair - Miss Becky
Russian Blue - Church
Miniature Poodle - Pierre LaPoodlePants
Banana BP - Yuri Katsuki
-
-
If you want something that holds their color without the yellow bleeding in the white which happen with many combos you want to look at Black Pastel Albino and Albino Pied
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
I have a high contrast albino and a low contrast albino. The high contrast really holds its color, I think it's all in the line of albino that really makes the difference.
-
The Following User Says Thank You to cchardwick For This Useful Post:
-
-
The Following User Says Thank You to Seven-Thirty For This Useful Post:
-
Re: Albino morphs that hold their pattern and color.
Combos with Albino that hold their contrast (i.e., low levels of blushing into the white and maintained yellow/gold colour) well are Albino BlkPastel or Cinny (as previously mentioned), Albino Spotnose, and Albino Woma. I am half inclined to disagree with Deborah as to the Albino Pied, the Pied sections obviously stay white but the white areas in the patterned sections tend to develop very high levels of blushing.
Albino Pin, Spider, Pastel, Enchi, Champ, Clown, GStripe, and hetBluEL group tend to develop into animals that are overall yellow with the patterning offset in varying shades/intensities of yellow.
I have not seen any examples of adult Albino Calico, GHI, Mahogany, BlackHead, hetBlkEL group but I suspect they all probably develop a degree of blushing
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Albino morphs that hold their pattern and color.
-
The Following User Says Thank You to ladywhipple02 For This Useful Post:
-
Registered User
my vote is for lavender albino...
Welcome to New Jersey Home of Taxes, Tolls, and Traffic
-
The Following User Says Thank You to Kirks_Herps For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|