Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,950

0 members and 1,950 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,917
Threads: 249,118
Posts: 2,572,207
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
Page 2 of 2 FirstFirst 12
Results 11 to 14 of 14
  1. #11
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Orange Dream: Does it age well?

    Quote Originally Posted by artgecko View Post
    Thanks for your responses and the great pics! You guys have beautiful animals.

    Enchi is one of my favorite genes, as well as fire. My first breeding project is centered around hypo, with a hypo calico female and a hypo enchi pastel kingpin female. I'm trying to figure out what genes I want in a male and OD is on my list... Haven't seen any pics of OD hypos though, so not sure about the combination. I like anything that brightens colors and reduces pattern though, so I'm thinking it might be a good combination.
    If your looking to make brighter snakes you should be looking into working with desert ghost. It will take any morph you work with to the next level. I eventually plan to make OD desert ghost along with a bunch of other combos. Any morph or combo of morphs will be greatly improved by adding desert ghost, by far the best enhancer morph!

  2. The Following 2 Users Say Thank You to rufretic For This Useful Post:

    Godzilla78 (10-28-2017),zina10 (10-30-2017)

  3. #12
    BPnet Lifer Albert Clark's Avatar
    Join Date
    02-22-2015
    Location
    Spotsylvania, Va.
    Posts
    4,651
    Thanks
    6,518
    Thanked 3,295 Times in 2,139 Posts
    Images: 39

    Re: Orange Dream: Does it age well?

    Quote Originally Posted by rufretic View Post
    If your looking to make brighter snakes you should be looking into working with desert ghost. It will take any morph you work with to the next level. I eventually plan to make OD desert ghost along with a bunch of other combos. Any morph or combo of morphs will be greatly improved by adding desert ghost, by far the best enhancer morph!
    I definitely agree with your outlook ruf! I want desert ghost also but for now gonna stick with the OD pied project and super OD for now.
    Stay in peace and not pieces.

  4. The Following 2 Users Say Thank You to Albert Clark For This Useful Post:

    rufretic (10-28-2017),zina10 (10-30-2017)

  5. #13
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts

    Re: Orange Dream: Does it age well?

    Quote Originally Posted by rufretic View Post
    If your looking to make brighter snakes you should be looking into working with desert ghost. It will take any morph you work with to the next level. I eventually plan to make OD desert ghost along with a bunch of other combos. Any morph or combo of morphs will be greatly improved by adding desert ghost, by far the best enhancer morph!
    I do intend to get into DG eventually... I wanted to grow out my hypo project animals, breed them, and then use those funds to purchase some DG animals. I agree with you about DG, it is the ultimate brightening gene.... Now, if I happen to come across a male DG that happens to be het hypo, well then, I might have to change my plans.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  6. The Following 2 Users Say Thank You to artgecko For This Useful Post:

    rufretic (10-28-2017),zina10 (10-30-2017)

  7. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Orange Dream: Does it age well?

    Quote Originally Posted by rufretic View Post
    OD is interesting in that it seems to age well when combined with the right morphs but on its own, at least from what I’ve seen, the orange color does not hold up well. The few adults I’ve seen have had beautiful clean patterns but had lost that bright orange coloring that you see when they are young.
    Ruf is correct about the single gene, as they age they mostly end up looking like a really nice clean normal


    Quote Originally Posted by rufretic View Post
    As for what morphs help them retain the color, enchi is the best that I’ve seen...
    Enchi is certainly one of the better morphs to combo with to help retain the colour into adulthood but even then the adults I have seen of this combo still end up a bit muted. Your other top candidates are Spider, Fire and anything in the YB group. Also, depending on the mix, Pastel can do some really nice things (the flip side being that in the wrong mix, Pastel swamps out the OD.) As a general rule of thumb, the dark morphs and the hetBluEL group do not go that well with OD, with some exceptions

    I have OD Pastel YB (600g), Butter OD Pastel Woma YB (600g) and Butter Enchi OD Pastel YB (1100g) and they are all very bright. And I had an Enchi OD YB that went to live with a friend that was retina-burning


    Quote Originally Posted by cchardwick View Post
    You can hardly tell a yellow belly from a normal when it's on it's own
    This is the third or fourth time I have seen this comment from you and I find it odd. YB is an established incomplete-dominant trait and it is not at all difficult to identify


    Quote Originally Posted by cchardwick View Post
    I'm thinking that there are many different lines of yellow belly with slight differences.
    That there are multiple lines of YB is an established fact -- RDR's Goblin, NERDs Bling, Seigel's OB, the dozen or so independently imported WCs that come in every year... And yes, each might have a slightly different expression pattern but they are all pretty obviously YBs
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (10-30-2017),Albey (11-03-2017)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1