» Site Navigation
2 members and 700 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Thoughts on mixing phantom with mystic
Any thoughts on mixing Phantom with Mystic? Currently I work with Phantom and I know that Phantom and Mystic are two different lines of the same gene. I would preferably stick with one or the other for clarity however there are two snakes I am interested in that could shorten the timeline on a couple projects I am working on by at least a year the only problem being that they are Mystics and it would require that I mix them with my Phantoms. Opinions??
Honest, I only need one more ...
-
-
if you're gonna keep all of the offsprings, that's fine. but if u sell, u would need to do so with the full disclosure of the Mystic-Phantom mix. stores probably won't care, most casual pet owners won't care but hobbyists and breeders will.
myself, i'm gonna try to keep my lines pure. i have Ian G lines of Black Pastel i won't be mixing with my other ones. the same w/ my Butter and Lesser. i have also only bought Banana's and not Coral Glows.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
JodanOrNoDan (10-13-2017)
-
Re: Thoughts on mixing phantom with mystic
 Originally Posted by Ax01
if you're gonna keep all of the offsprings, that's fine. but if u sell, u would need to do so with the full disclosure of the Mystic-Phantom mix. stores probably won't care, most casual pet owners won't care but hobbyists and breeders will.
myself, i'm gonna try to keep my lines pure. i have Ian G lines of Black Pastel i won't be mixing with my other ones. the same w/ my Butter and Lesser. i have also only bought Banana's and not Coral Glows.
I agree. You are making the exact points I was making last night when I was discussing this with someone. Glad to hear I am not the only one that thinks this way.
Honest, I only need one more ...
-
-
Re: Thoughts on mixing phantom with mystic
 Originally Posted by JodanOrNoDan
I know that Phantom and Mystic are two different lines of the same gene.
Tracking some of the trends on these for the last few years I am actually inclined to think that they might indeed be different alleles from one another. Not radically different mind, something along the lines of Baker-line Special versus TCR-line Special kind of different.
Now, as far as mixing the lines... Personally, I would be leery of blending them, for pretty much the reasons Ax outlined. But that is just me. Ultimately it is up to you on whether you want to move your project on faster or whether you want to keep pure lines.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (10-16-2017)
-
Re: Thoughts on mixing phantom with mystic
 Originally Posted by asplundii
Tracking some of the trends on these for the last few years I am actually inclined to think that they might indeed be different alleles from one another. Not radically different mind, something along the lines of Baker-line Special versus TCR-line Special kind of different.
Now, as far as mixing the lines... Personally, I would be leery of blending them, for pretty much the reasons Ax outlined. But that is just me. Ultimately it is up to you on whether you want to move your project on faster or whether you want to keep pure lines.
I am curious as to what differences you are seeing between the two lines are. I initially thought that I possibly had two lines of Phantom. One appeared significantly different than the other, even the babies. One of the founding animals I bought directly from RDR so I know exactly what that one is. The other came in a multi-gene male. I do not know where the male's phantom gene originated from but he produced clutches of animals that consistently showed a more refined, sharper, brighter animal than the RDR Phantom. That was up until this season. One baby out of about 20 phantom combos popped out that looked exactly like my RDR phantom. I have yet to mix the two lines, but I no longer think that the lines in my collection are different.
I have seen a difference in Purple Passion/Mystic Potions that I think is pretty consistent, but from my experience, It may have more to do with the level of darkness in the mojave gene. I will find out this season. I have a very light Purple Passion that I am going to cross to a very dark mojave (not related), and also back to his mother who is a very light mojave.
Honest, I only need one more ...
-
-
Not visually different enough to mix them IMO without having issues down the road trying to sell them. People still care about linage especially those that breed and one day will have to tell their customer what they are getting.
Things like CG or Banana, Lesser or Butter, Fire or Sulfur matters to some even though it's a matter of lines and no one cares about the different Pastel, or Hypo lines (so long they are compatible).
I have had customers dead set on CG and not wanting Bananas (I do work with both but I do not mix them up)
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
JodanOrNoDan (10-16-2017)
-
If people only knew how many butters are sold as lessers now, cgs sold as banana, *insert color* hypos are sold as hypo, unknown hypos sold as orange ghost, ect....
To me it depends, how sure are we they are the same thing? I mean fire, sulfur, sauce are indistinguishable in the base form, but the lucys of each are very different. But then sauce and lemonback so far appear to be the same thing. However I wouldn't mix them yet, as there hasn't been a ton of examples.
Things like butter and lesser have been around long enough where I personally wouldn't care if someone relabeled it. As if you had a clutch of butter or lessers and just called the babies lessers. Especially since there are 3 known lines of lesser and 2 of butter (and perhaps more). Given the eruption of bananas and cgs all over, I'm on the fence about being OK with relabeling them. There's going to be a some banana/CG "super bananas" in a couple years.
Mystic and phantom I personally havn't seen enough with to have an opinion on that. If you are going to mix them I'd suggest you be a sure as you can possibly be about them being the same. If there's any doubt I'd shy away from it for now.
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
JodanOrNoDan (10-19-2017)
-
Re: Thoughts on mixing phantom with mystic
 Originally Posted by JodanOrNoDan
I am curious as to what differences you are seeing between the two lines are...
I have seen a difference in Purple Passion/Mystic Potions that I think is pretty consistent
It is subtle things that are, yes, mostly when seen within the rest of the BluEL group but then the same holds for the different lines of Special as well. The differences you noted between the Passions versus the Potions, also differences in the supers themselves. The tendency toward dorsal striping in the more extreme heteroallelic supers (Karma versus Lesser/Mystic, Leche versus Mocha/Mystic). There also seems to be a slightly higher degree of lateral pattern disruption in Phantom combos versus Mystic combos.
 Originally Posted by JodanOrNoDan
It may have more to do with the level of darkness in the mojave gene.
While I do not discount this possibility the differences I have seen extend beyond just Mojave combos so I do not think it is the sole cause
 Originally Posted by JodanOrNoDan
...but I no longer think that the lines in my collection are different...
If memory serves me, NERD has their own line of independently imported Phantom. I think the first PurplePassions photographed were from that line. So your speculation may have merit...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (10-19-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|