Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 626

1 members and 625 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 2 FirstFirst 12
Results 11 to 12 of 12
  1. #11
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Definition of allele

    Alleles are two different genes that can make a gene pair. Example: a normal gene and an albino gene. This gene pair makes a het albino snake. Example: a mojave gene and a lesser gene. This gene pair is one way to get a blue-eyed white ball python.

    Alleles have slightly different DNA sequences, but they are located in the same place in the genome.

    The albino mutant gene and the mojave mutant gene are not alleles. They cannot make a gene pair because the have different locations in the genome.

    Hope that helps.
    Last edited by paulh; 10-04-2017 at 09:30 PM.

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Definition of allele

    Quote Originally Posted by paulh View Post
    Alleles are two different genes that can make a gene pair. Example: a normal gene and an albino gene. This gene pair makes a het albino snake.
    That is not correct, alleles are not different genes. Alleles are different forms of the same gene So, using the Albino as an example, you have two different forms of the tyr gene, one that is fully functional and one that is non-functional. Loop Candy in and you have a third form of the gene, one that is low functioning.

    An easy way to think about it is like a flight of cards, ace through king; the face of the card is the gene and the suit of the card is the allele. If we assign the gene for Albino to the 3 card you can then have a pair of 3s that are both spades (WT), a pair of 3s that are both hearts (Albino), a pair of 3s that are spade and heart (het Albino), a pair of 3s that are both clubs (Candy), a pair of 3s that are spade and club (het Candy), or a pair of 3s that are club and heart (Candino).
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1