Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,235

0 members and 1,235 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,936
Threads: 249,129
Posts: 2,572,284
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 6 of 6
  1. #1
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Maybe banana albino?? What would it even look like

    This is the second year last year i got 3 albinos poss bananas did the same pairing and got 1 albino and I'm really wondering what a banana albino should look lile

    Sent from my SM-G920W8 using Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    An Albino Banana looks like a 9somewhat lighter) Albino. This is not surprising because Albino strips all melanin away so the "pink" of a Banana is removed. There are a few threads here on the forum about this I believe.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    Albino CG's and Banana's have been produced. Gerrick, Corey and others have produced them. i recall that clutch of yours. i remember u thinking that u thought the Albino Banana's were all pink, patternless when u cut the eggs. but they all ended up with patterns anyway.

    as asplundii and others have mentioned, they look like regular albino's. besides the freckles, Banana's are pretty much color morphs. as for the freckles appearing in Albino Banana's, they would not as the Albinism would eliminate all the black from the start. your best bet is to hold one back and prove it out (or breed a Super Banana het Albino to another Albino).
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  4. The Following User Says Thank You to Ax01 For This Useful Post:

    dr del (09-25-2017)

  5. #4
    Registered User mwolf's Avatar
    Join Date
    06-18-2015
    Posts
    91
    Thanks
    72
    Thanked 55 Times in 31 Posts

    Re: Maybe banana albino?? What would it even look like

    Theoretically, you might be able to tell if it's a banana based on the sex of the hatchling as well. For example, if you're breeding a male maker banana het. albino then almost all male babies would have the banana gene, except on the chance that you hit the very slim odds of producing a female banana. In male maker banana clutches all non-banana offspring are (usually) females.

  6. The Following User Says Thank You to mwolf For This Useful Post:

    nightwolfsnow (09-26-2017)

  7. #5
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Re: Maybe banana albino?? What would it even look like

    I haven't heard of any of them producing them but thanks I'll hit him up with a pm and see if he can help as I love watching gerricks YouTube

    Sent from my SM-G920W8 using Tapatalk

  8. #6
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Re: Maybe banana albino?? What would it even look like

    Quote Originally Posted by asplundii View Post
    An Albino Banana looks like a 9somewhat lighter) Albino. This is not surprising because Albino strips all melanin away so the "pink" of a Banana is removed. There are a few threads here on the forum about this I believe.
    Lol probs me asking as I did this last year aswell it's something I'm really wanting to make but slowly thinking it's going to be a long haul but all but 1 albinos from the 2 clutches were males so if it's a sex linked thing aswell then I may have sold a few as normal albinos lol and 1 super faded albino

    Sent from my SM-G920W8 using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1