» Site Navigation
1 members and 1,332 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
|
-
Registered User
-
-
Re: Lavender Albino or not?
Well I know Candino's have the darker ruby eye coloration as opposed to reg albinos that have the pink eye color. Are you sure this is the lavender albino gene you are working with? The first pic looks like a regular albino. Maybe we need to wait on subsequent sheds to really tell. Maybe the mother is het albino and not lavender albino ?
Last edited by Albert Clark; 09-21-2017 at 01:13 PM.
 Stay in peace and not pieces.
-
The Following User Says Thank You to Albert Clark For This Useful Post:
-
how sure are you on those hets?
I have to second the candy/toffee sugestion
that baby looks like a candino/toffino to me but only time will tell (I may not be the best judge on lav as I don't work with it, but I do work with toffee)
Laziness is nothing more than the habit of resting before you get tired.
-
-
Registered User
Re: Lavender Albino or not?
The father is definitely lavender albino 50% het for pied. The mother was sold to me as proven het for lavender albino. This was my first time breeding her but if she was het for albino the babies would all be visually normal. The photos of the two babies are both from her clutch so she must be het for lavender albino unless the father carries some other gene. The mother laid ten eggs which all hatched, producing seven visual lavender albino, two visual normal, and the oddball with dark eyes.
-
-
If you are sure about the hets then the only explanation is he's just a bit odd. Personally I'd hold him/her back. Just to see
Laziness is nothing more than the habit of resting before you get tired.
-
-
Re: Lavender Albino or not?
 Originally Posted by piedpiperballs
The father is definitely lavender albino 50% het for pied. The mother was sold to me as proven het for lavender albino. This was my first time breeding her but if she was het for albino the babies would all be visually normal. The photos of the two babies are both from her clutch so she must be het for lavender albino unless the father carries some other gene. The mother laid ten eggs which all hatched, producing seven visual lavender albino, two visual normal, and the oddball with dark eyes.
Do the other lavender albinos look like the first pic as far as the coloration, or the second? Maybe it's a random genetic influence on the eye color?
 Stay in peace and not pieces.
-
-
Registered User
Re: Lavender Albino or not?
 Originally Posted by Albert Clark
Do the other lavender albinos look like the first pic as far as the coloration, or the second? Maybe it's a random genetic influence on the eye color?
The seven lavender albino babies all look alike. Following are photos of the two normal looking babies in case you see something in them. 
Sent from my LG-D415 using Tapatalk
-
-
Registered User
Re: Lavender Albino or not?
Could it be a lavender snowball?
-
-
Paradox that only effected the eyes?
-
-
Re: Lavender Albino or not?
 Originally Posted by Albert Clark
Well I know Candino's have the darker ruby eye coloration as opposed to reg albinos that have the pink eye color.
Candino eyes do not look like that. Especially not at hatching
 Originally Posted by Albert Clark
The first pic looks like a regular albino.
Lavs typically hatch out looking like normal Albinos and their colouring flushes in as they age
Based on the fact that the whole animal is pigmented my inclination is to say it is just genetic variation just popping out and surprising you a bit and the animal is a regular Lav that happened to start colouring up significantly earlier than expected. Odd question -- What were your incubation temps and was this specific animal's egg someplace where it would have been colder than the rest of the eggs?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Albert Clark (09-22-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|