Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 829

0 members and 829 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,908
Threads: 249,107
Posts: 2,572,126
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    BPnet Veteran
    Join Date
    09-13-2017
    Posts
    594
    Thanks
    1,160
    Thanked 507 Times in 292 Posts

    Hognose: The good, bad and ugly....

    This is all of you Hognose snake owners. Getting a hognose is on my list of snakes, but I've heard many stories about them that keeps me sitting on the fence. Although you can't help but to love that adorable stuck up nose.

    So if you own one of these cuties with an attitude, tell me about yours and the good, bad and ugly they display



  2. #2
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Hognose: The good, bad and ugly....

    They are possibly the second cutest of all snakes after Rhino Nosed Rat snakes ..
    Being hypersensitive to just about everything I can't risk having one ( or more) due to them being rear-fanged and mildly venomous ...



    Sent from my iPhone using Tapatalk




  3. The Following User Says Thank You to Zincubus For This Useful Post:

    Jus1More (09-19-2017)

  4. #3
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    The good

    Great snake, easy to care for, fun personality, fantastic feeders (females)

    The bad

    The are venomous and while they are not prone to bite (I am usually a bite magnet and never been bit by a hog) it is something to keep in mind because even though the venom is mild and the delivery method is poor reaction vary from an individual to another.

    Unreliable feeders (males)
    Deborah Stewart


  5. The Following 4 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    AlexisFitzy (09-18-2017),Craiga 01453 (09-19-2017),Jus1More (09-19-2017),Zincubus (09-19-2017)

  6. #4
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    I second everything Deborah has said. They're great pets, very active and full of personality. The girls eat like pigs, but I've had no luck getting my boy off live and onto f/t. I hope I can before he gets big enough to eat hoppers. Hognose snakes don't constrict, they just chomp, so I'd prefer not to feed anything big enough to cause damage.

    ...and unlike Deborah I have been bitten a few times. Usually because I forget to wash my hands after handling the mice I breed. Out of those few times, only one broke skin (hungry girl, she latched onto my finger and chewed until I got to the nearest sink).

    I had no reaction to the venom. If someone assaulted my finger with a thumbtack I think it would do more damage then her fangs did.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  7. The Following 3 Users Say Thank You to the_rotten1 For This Useful Post:

    Craiga 01453 (09-19-2017),Jus1More (09-19-2017),Zincubus (09-19-2017)

  8. #5
    BPnet Veteran
    Join Date
    10-13-2016
    Location
    VT
    Posts
    246
    Thanks
    139
    Thanked 225 Times in 113 Posts

    Re: Hognose: The good, bad and ugly....

    I started out with hognoses when a breeder gave me a very kinked hatchling a couple of years ago. She lived a year and a half before passing naturally, and even though I have a corn snake and ball pythons I missed her so much I recently picked up a pair of hatchlings. This pair is already super fast compared to Kinky, the kinked hog, but they all have seemed to be pleasantly engaging. Also, when they're grown up I'll be able to use the same prey size mice as my corn snake, but they are my only snakes on shredded aspen (a tiny amount currently, lol.)

    Sent from my SM-G950U using Tapatalk

  9. The Following User Says Thank You to Tila For This Useful Post:

    Jus1More (09-19-2017)

  10. #6
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    I had feeding issues with my male. Started off eating f/t pinkies (unscented) as advertised by the breeder. Within ~3 months, he decided that he was deathly afraid of tongs / hands and thus, would no longer take non-moving f/t prey. I got him to take live rat pinks a few times (which I didn't regularly have available) so I ended up rehoming him to someone who produced live for him and he is now doing fine. With me, he got into pretty much starvation condition due to constant feeding strikes, etc. so I was glad to place him with someone who could produce live regularly to feed him.

    Due to that experience, I haven't been back for another try lol. If I do, I'll go with a well-established juvie female that is eating unscented f/t in hopes that she will be a good feeder.

    On the good side, they are cute and active and seem to be pretty hardy.

    Mine never bit, so I can't attest to how I'd react to the venom.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  11. The Following User Says Thank You to artgecko For This Useful Post:

    Jus1More (09-19-2017)

  12. #7
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts
    To start, I agree with a lot of what has been said already.

    My boy, Cosmo came to me unexpectedly after a former coworker asked me to try to get him to eat. Apparently he was over a year old and had never eaten for her in the six months she had him and had only eaten once in a few months for the previous owner. So I agreed to try to get him eating for my coworker and once established she would take him back. Well, cruising over the details, she was fired and disappeared. After a few months of her barely replying to texts, etc... I kinda assumed I'd end up keeping him.

    I'm super stoked it worked out the way it did. Cosmo is an awesome little snake. He came to me at 11 grams in late March and by mid August he had hit 40 grams and was doing well.
    However, he went of food for a bit... until last night!!! He actually ate last night for the first time in 4 weeks. I wasn't sweating it, just figured he was a male hognose doing what they do.

    All in all, my experience with Cosmo has been great. He's an adorable little goofball with tons of personality. He handles extremely well and has shown no real defensive behaviors that can be common from what I've read. He will occasionally puff up his neck, but has never struck, rattled his tail at me or even hissed at me. He will hiss and fake strike at his prey sometimes when I'm putting it into his enclosure using tongs, then I just leave it and he eats a few minutes later (with the exception of his feeding strike).

    So, in closing, I would advocate for adding a hognose to the family as long as you're aware of the rear-fangs and extremely mild venom and horrible delivery system. That said, I have read of VERY few hognose bites and even fewer bites that resulted in any adverse reaction.

    I will definitely be adding another hognose to my family at some point.

  13. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    Jus1More (09-19-2017)

  14. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The venomous thing has been covered.

    The only other "bad" I would put out there is that their metabolism is higher so they tend to crap a LOT and for some reason they seem to like to wait until 30 seconds after you just cleaned their tub to do it and then spread it around... So I clean their tubs first and then go back and clean their tubs again once I am done cleaning everyone else. And then I come back and clean their tub again the next day.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  15. The Following User Says Thank You to asplundii For This Useful Post:

    Jus1More (09-19-2017)

  16. #9
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: Hognose: The good, bad and ugly....

    Quote Originally Posted by asplundii View Post
    The venomous thing has been covered.

    The only other "bad" I would put out there is that their metabolism is higher so they tend to crap a LOT and for some reason they seem to like to wait until 30 seconds after you just cleaned their tub to do it and then spread it around... So I clean their tubs first and then go back and clean their tubs again once I am done cleaning everyone else. And then I come back and clean their tub again the next day.

    This is a good point that hadn't been covered. Also, by comparison to any other snakes I've kept (BPs, Kings, corns) hognose poop is BY FAR the most stinky. It honestly smells like cow manure to me. And how a tiny little snake can poop such a tiny little poop that packs such a punch is beyond me. But, proper spot cleaning eliminates the problem.
    Last edited by Craiga 01453; 09-19-2017 at 08:54 AM.

  17. #10
    BPnet Veteran Prognathodon's Avatar
    Join Date
    09-21-2015
    Location
    NE Illinois
    Posts
    1,194
    Thanks
    1,344
    Thanked 923 Times in 550 Posts
    Images: 2

    Re: Hognose: The good, bad and ugly....

    My husband's hoggie has a lopsided head, and I think has vision issues on one side, so it her affects her behavior and feeding. Due to that, once she gets the feeder in her mouth she eats great, and once you get her in-hand, she's fine being handled, but she can be very flaky beforehand. We've both been bit a few times until we figured out the best way to approach her, but only once resulted in an envenomation. For a while we were feeding her outside her enclosure due to her issues, and when I picked her up to put her back, she was still in food mode and tried to eat my finger. It itched for a little while, not even as bad as honeybee stings for me. Since then, she eats in her enclosure.

    Exchange while I was being viciously nommed by a small snake:
    Husband: "I can't find the vodka"
    Me: "Just grab the good rum! She's trying to drag me away!"


    Sent from my iPad using Tapatalk Pro
    0.4 BPs, 0.1 Antaresia, 2.1 Morelia, 0.0.1 Liasis, 1.0 Aspidites, 0.1 Blood, 1.1 Kings, 2.0 Milks, 1.2 Corns, 2.0 Ratsnakes, 0.1 Hognose, 1.0 RTB, 2.1 KSBs, 1.0 Tortoise, 1.0 Skink, 3.0 dogs, 2.1 Human serfs

  18. The Following 4 Users Say Thank You to Prognathodon For This Useful Post:

    Craiga 01453 (09-20-2017),distaff (09-20-2017),Jus1More (09-19-2017),RickyNY (09-19-2017)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1