» Site Navigation
0 members and 664 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,198
Top Poster: JLC (31,651)
|
-
Very cool! Thanks for taking the time to post them, nothing beats pictures for showing your point. The firefly calico yb is super cool!
-
The Following User Says Thank You to rufretic For This Useful Post:
-
MS2- Thank you for the pics! I'm assuming the pinkish areas on the belly will turn white with age?
My main issue with calico is that even when you have high white animals, when they combine with other morphs, I have never seen a high white one produced that still retains patterning..It seems like the calico changes the pattern as well as producing less white in these instances. Maybe I just haven't seen enough of them to see good examples though.
Currently keeping:
1.0 BCA 1.0 BCI
1.0 CA BCI 1.1 BCLs
0.1 BRB 1.2 KSBs
1.0 Carpet 0.5 BPs
0.2 cresteds 1.2 gargs
1.0 Leachie 0.0.1 BTS
-
-
If you want high expression of white in a Calico combo then go with Enchi or Spider. OD also seems to push toward higher white expression. Pastel combos push higher as well but also tend toward disrupted pattern.
BluEL complex, BlkEL complex, YB complex, and SuperBlk complex seem to push toward lower expression of the white. Likewise Clown and GStripe seem to cause lower expression. Most of the Calico Pins I have seen have not been particularly dramatic either.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Question about calico (and other morph interactions)
I love a good high white calibee <3
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
-
Re: Question about calico (and other morph interactions)

My girl is a low expression Calico. Here's her on the clutch. Definitely does some wacky stuff with the patterns.
Sent from my iPad using Tapatalk
-
-
Re: Question about calico (and other morph interactions)

Pastel Calico Yellow Belly Orange Dream!
-
The Following User Says Thank You to Albey For This Useful Post:
-
Registered User
I just hatched out a sweet clutch from my male Banaha hypo x female Calico Killerbee for a pastel, bumblebee, pastel calico, calibee, banana pastel poss calico and a banana calibee. All females except for the banana pastel. I will be holding back the
female banana calibee as it was my goal for this clutch
1.0 Banana Hypo
1.0 Pastave Enchi
1.0 Pastel +
0.1 Normal Het. Hypo
0.1 Killer Blast
0.1 Killer Calibee
0.1 Queenbee
-
-
Re: Question about calico (and other morph interactions)
Hope i'm not side tracking but may i suggest sugar. I like sugar more cause they are more consistent in the middle of the amount of white that show where as calico it tends to either be high or low white. But i do like calico so go either way i guess.
I just took and uploaded these pics of my sugar bee.



Out of my whole collection i needed some updated pics of her the most next to my albino boa who is overdo for some new pics. Can you believe i only paid $225 for her. The seller claimed he made a mistake in posting the price and honored the listed price. I'm not a genetic expert but i do believe she is a sugar.
Last edited by EDR; 09-07-2017 at 11:30 PM.
0.1 : Albino Clown - GHI Pastave - Killer Bee Fader - Sugar Bee - Pastel het pied - Lemon Blast het puzzle
1.0 : Banana - Mystic Potion 66% pos het pied - Pastel Lesser het puzzle - Super Pastel 66% pos het puzzle
1.0 2012 Albino Red Tail
-
The Following 2 Users Say Thank You to EDR For This Useful Post:
dr del (09-08-2017),KayLynn (09-08-2017)
-
Thanks for the pics guys!
Asplundii- Thank you for that information. I was planning on working with enchi and pastel already, but I will keep the other morphs you mentioned in mind.
Albey- Nice looking calico! In your animal's pic, I notice there is some lightening of the pattern near the belly (the areas between the parts that will turn white). Almost "orange" looking. Is this due to the calico influence or the orange dream?
MDR- Nice looking animal. I had read that sugar was a line of calico and that they tended to be nicer (higher expression) but there don't seem to be many for sale.
Honestly, I'm still on the fence. If the hypo pastel calico I am considering was a female, then I think I'd jump on it... But with it being a male and me wanting to limit my males, I'm not sure if I will purchase it or not. If it was an hypo enchi calico, it would be a better fit, as I am wanting to introduce enchi into my future hypo project. I think the same breeder has a calico hypo female for sale, so I may inquire about her to see how high expression she is.
Currently keeping:
1.0 BCA 1.0 BCI
1.0 CA BCI 1.1 BCLs
0.1 BRB 1.2 KSBs
1.0 Carpet 0.5 BPs
0.2 cresteds 1.2 gargs
1.0 Leachie 0.0.1 BTS
-
The Following User Says Thank You to artgecko For This Useful Post:
-
Re: Question about calico (and other morph interactions)
 Originally Posted by EDR
Hope i'm not side tracking but may i suggest sugar. I like sugar more cause they are more consistent in the middle of the amount of white that show where as calico it tends to either be high or low white. But i do like calico so go either way i guess.
Out of my whole collection i needed some updated pics of her the most next to my albino boa who is overdo for some new pics. Can you believe i only paid $225 for her. The seller claimed he made a mistake in posting the price and honored the listed price. I'm not a genetic expert but i do believe she is a sugar.
I'm on the sugar bus... I know it's just another "line" of calico, but it seems to express the white gene better/in higher amounts.
I'm also a fan of the calico/sugar mixed with orange dream, and spiders, of course. I love my spiders, but when you throw in the high white sugar with some OD, I get heart palpitations.
-
The Following User Says Thank You to ladywhipple02 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|