Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 916

0 members and 916 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,050
Threads: 249,210
Posts: 2,572,717
Top Poster: JLC (31,651)
Welcome to our newest member, Urceolate
Page 4 of 4 FirstFirst 1234
Results 31 to 33 of 33
  1. #31
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Known Genetic Defects?

    Quote Originally Posted by OhhWatALoser View Post
    The only info is the absence of records or the animal itself. Try finding records of a woma x woma pairing, most refer to hgw x hgw before people knew they were hgw and not woma. woma x spiders are claimed to be viable by many as "they have one" yet I haven't been able to find one that actually proved out to have both woma and spider gene. So there no evidence of them being lethal besides the absence of evidence. What if woma is just a dominant morph, what if spider womas are allelic. Given I feel it is unlikely looking at correlations with other neuro morphs, still the thing is we don't know, we just assume. I'm even fine with educated assuming, but what data are we assuming based off of? Almost nothing.

    ....
    Breeding black head to woma might be more productive than spider to woma. The black head and spider genes seem to be allelic, so if black head and woma are allelic, then spider and woma are also allelic. With black head/spider ball pythons viable, then black head/womas are likely to be viable, too.
    Last edited by paulh; 07-31-2017 at 05:31 PM.

  2. #32
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Known Genetic Defects?

    Quote Originally Posted by paulh View Post
    Breeding black head to woma might be more productive than spider to woma. The black head and spider genes seem to be allelic, so if black head and woma are allelic, then spider and woma are also allelic. With black head/spider ball pythons viable, then black head/womas are likely to be viable, too.
    If I had a blackhead I would try it, but I do not.

  3. #33
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Known Genetic Defects?

    Quote Originally Posted by JodanOrNoDan View Post
    It is my suspicion that woma, champagne etc will prove out to be co-dom just like the spider and some if not all turn out to be allelic with spider.
    Quote Originally Posted by paulh View Post
    Breeding black head to woma might be more productive than spider to woma. The black head and spider genes seem to be allelic, so if black head and woma are allelic, then spider and woma are also allelic. With black head/spider ball pythons viable, then black head/womas are likely to be viable, too.
    The idea that Spider, Champ, Woma and HGW might be allelic has been around for a while, Nick Mutton first mentioned it to me five or six years ago. I had the same thought about breeding Blackhead to them to prove it out shortly after BH and Spider were shown to be allelic. To date HGW/BH and Champ/BH have been made but I have not heard of them being bred out. The HGW/BH was done by Matt Leher (sp??) three years back so I would think it should be breeding size by now assuming it was male. The first Champ/BH I heard of was made in '16 and the guy was a first time breeder and did not know the sex of the animal. I have not heard anything about how that animal has matured/fared...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    paulh (08-02-2017)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1